ID: 1163833868

View in Genome Browser
Species Human (GRCh38)
Location 19:19561879-19561901
Sequence CACGGGCCTGGCTGAGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 1, 2: 5, 3: 43, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163833860_1163833868 12 Left 1163833860 19:19561844-19561866 CCATCTCGAGTCGCAGCAGACAC 0: 1
1: 0
2: 1
3: 1
4: 63
Right 1163833868 19:19561879-19561901 CACGGGCCTGGCTGAGGAGCAGG 0: 1
1: 1
2: 5
3: 43
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163833868 Original CRISPR CACGGGCCTGGCTGAGGAGC AGG Exonic
900087242 1:904448-904470 CCCGGGCCTGGCGGTGGAGGGGG - Intergenic
900139505 1:1133626-1133648 CACAGGTCTGGCTGGGGAGGTGG + Intergenic
900182849 1:1320008-1320030 CACGGGCCTGGCTGCTGGGGAGG + Intronic
900506216 1:3030885-3030907 CTGGGGCCTGGGTGAGGGGCTGG - Intergenic
901146700 1:7069708-7069730 CAGGGGACTGGCAGAGGAGCTGG + Intronic
901641319 1:10694528-10694550 CGCGGGCCGGGCCGAGGAGGCGG - Intronic
902193898 1:14783717-14783739 CGGGGTCCTGGCTGAGGAGTAGG + Intronic
902402651 1:16166585-16166607 AAGGGACCTGGATGAGGAGCTGG + Intergenic
902466953 1:16624326-16624348 CGCTGGCCTGGCTGTGCAGCTGG - Intergenic
902479008 1:16701994-16702016 CAGGCGCCTGGCTGAGGCTCTGG - Intergenic
902507646 1:16948450-16948472 CGCTGGCCTGGCTGTGCAGCTGG + Exonic
902747672 1:18484093-18484115 CATGGGCAGGGCCGAGGAGCAGG - Exonic
903459771 1:23512504-23512526 CAGAGGCCTGGCTTGGGAGCGGG + Intronic
903576105 1:24340806-24340828 CACCGGGCTGGAGGAGGAGCTGG + Intronic
903846457 1:26282259-26282281 CAAGAGCCTGGCGGAGCAGCGGG + Intronic
904035237 1:27555502-27555524 CCCAGGCCTGGCTGTGGACCTGG + Intronic
904567550 1:31436754-31436776 CAGGGGCCAGGCTGAGAAGCTGG + Intergenic
905293668 1:36940653-36940675 GAGGGGCCTGGCAGAGGAGAAGG + Intronic
906089280 1:43164609-43164631 CAGGTGCCCGGGTGAGGAGCAGG - Intronic
906200535 1:43957362-43957384 CACTGGCTTGGATGAGGAGGAGG - Intronic
906935380 1:50209902-50209924 CACCTGCCTGGCTGAGGAGGAGG + Intergenic
907251503 1:53142581-53142603 CACGGGCATGGCCGTGGGGCTGG - Intronic
907354914 1:53864161-53864183 CACGTGCCTGGCTGAGAAGTTGG - Intronic
907415858 1:54313382-54313404 CTAGTTCCTGGCTGAGGAGCAGG - Intronic
912573127 1:110639179-110639201 CAGGGGCCTGCCTGAGAATCTGG + Intergenic
912831192 1:112955764-112955786 CCCAGGCCTGGCCGAGGAGTTGG - Exonic
913062444 1:115220585-115220607 CAGAGGCCTGGCTGATGGGCTGG + Intergenic
913666973 1:121057654-121057676 GAGGGGCCTGGCTGAAGACCTGG + Intergenic
914018718 1:143845078-143845100 GAGGGGCCTGGCTGAAGACCTGG + Intergenic
914657271 1:149753281-149753303 GAGGGGCCTGGCTGAAGACCTGG + Intergenic
915121377 1:153631614-153631636 CAAGGGGGTGGTTGAGGAGCAGG - Intronic
916562095 1:165941791-165941813 CCCGGGCCAGGCTGAGGGGCGGG + Intergenic
917589731 1:176463755-176463777 CACAGGCCTGGATGAGGCCCAGG - Intronic
918928310 1:190816734-190816756 CACAGGCCTGAATGAGCAGCTGG - Intergenic
919970350 1:202572811-202572833 CAAGGGCAGGGCTAAGGAGCAGG - Intronic
920059684 1:203218659-203218681 CACGATCCTGGCTGGGGAGATGG - Intronic
920065825 1:203268951-203268973 CACGGCCCTGGCTCAGGCCCTGG + Intronic
921164414 1:212496346-212496368 GAGGGGTCTGGCGGAGGAGCAGG - Intergenic
922566254 1:226603681-226603703 CACAGTCCTGCCTGAGAAGCGGG + Exonic
922707264 1:227795972-227795994 CAGGGGCCCTGCTGAGGCGCTGG - Intergenic
924637020 1:245798196-245798218 CGCAGGCCAGGCTAAGGAGCTGG - Intronic
924865509 1:247975234-247975256 CACAGCCCTGGCTGAGCAACAGG - Intronic
1062815987 10:500240-500262 CCCTGGCCTGTCTCAGGAGCAGG + Intronic
1062833170 10:619551-619573 CACGGGAGTGCGTGAGGAGCTGG - Intronic
1062975244 10:1678140-1678162 CAGGGGCTTGGCTGAGGGGTCGG + Intronic
1065101275 10:22335211-22335233 CCCCGGCCGGGCAGAGGAGCGGG + Intergenic
1065478830 10:26171706-26171728 CACAGGCCTGCCTCAGGAGCAGG + Intronic
1065818117 10:29500329-29500351 CACTGGGCTGGGTGGGGAGCGGG + Intronic
1065954803 10:30684176-30684198 CACTGGGCTGGGTGGGGAGCGGG - Intergenic
1067575152 10:47404160-47404182 CCCAGGCCAGGCTGGGGAGCTGG + Intergenic
1069900700 10:71705174-71705196 CACAGGCCTGGGTCAGGGGCAGG + Intronic
1071517804 10:86310548-86310570 CAGTGCCCTTGCTGAGGAGCAGG + Intronic
1071531226 10:86391604-86391626 CAGAGGCCAGGCTGAGGAGGAGG + Intergenic
1072619044 10:97067816-97067838 CACGGGCCTGGCCCAGGAGGAGG - Intronic
1073490817 10:103852197-103852219 CAGGGGCCTGGCAGAGAAGAAGG + Intronic
1074029928 10:109676952-109676974 CAGGGGCATGTCTGGGGAGCTGG + Intergenic
1075352235 10:121734217-121734239 CAATGGGCAGGCTGAGGAGCTGG + Intergenic
1076000235 10:126907294-126907316 CAGGAGGCTGGCAGAGGAGCAGG + Intronic
1076827870 10:132978940-132978962 GATGGGCCTGGCTGAGGAGCTGG + Intergenic
1076836035 10:133021371-133021393 CGGGGGCCTTGCTGAGGAGCTGG - Intergenic
1076898538 10:133325799-133325821 CCCGGGCCGGGCTGCGGGGCTGG + Exonic
1077093350 11:789308-789330 CACGGCCCATGCTGAGGAGGGGG - Intronic
1077151601 11:1075360-1075382 CACAGCCCTTGCTGGGGAGCGGG + Intergenic
1077501181 11:2910423-2910445 CTAGGGCCTGTCTGAGGAGGCGG + Intronic
1077578171 11:3399953-3399975 CACGTGCCAGTCTGTGGAGCAGG - Intergenic
1078655314 11:13233426-13233448 AAGGGGCCAGGCTGGGGAGCAGG - Intergenic
1079112480 11:17612604-17612626 CACCGGCCTGGGGGAGGGGCAGG - Exonic
1080839484 11:35970992-35971014 CACAGGCCTGGCTGAGCACCAGG - Intronic
1083732603 11:64660906-64660928 CCGGGGCCTGGCTGAGGCTCAGG - Exonic
1084085032 11:66851072-66851094 CATGGGCTTGGCCGAAGAGCTGG - Exonic
1084334243 11:68447418-68447440 CCCAGGCCTGGCTGGGGAGCCGG + Intronic
1085204259 11:74721158-74721180 CACGGGCCCAGCTGGGGTGCTGG + Intronic
1085322943 11:75585693-75585715 CATGGGTGTGGCTGAGGACCGGG - Intergenic
1085469014 11:76744894-76744916 CATGGGCCTCTCAGAGGAGCCGG - Intergenic
1089138502 11:116268285-116268307 CAAGGGCCTGGAGGAGGCGCTGG - Intergenic
1089882744 11:121790630-121790652 CACTGGCATTCCTGAGGAGCAGG + Intergenic
1090414941 11:126534374-126534396 CCTGGGCATGGCAGAGGAGCAGG + Intronic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1091310888 11:134574494-134574516 CACAGCACTGGCTGGGGAGCTGG + Intergenic
1092226800 12:6753112-6753134 CCCGGGCCTGGCCGAGGTTCGGG - Exonic
1092290446 12:7157032-7157054 CACGGGCTTGGCTGAGCAGGAGG - Intronic
1094331836 12:29302442-29302464 CACGTGCCTGGCAGGGCAGCTGG + Intronic
1095829695 12:46570730-46570752 CTGGGGCCTGTCGGAGGAGCGGG - Intergenic
1095936066 12:47682960-47682982 CAGGGGCCTGCCTGAGTATCTGG + Intronic
1095960058 12:47828861-47828883 CCAGGCCCTGGCTAAGGAGCTGG - Intronic
1102060059 12:109925209-109925231 CAGGGGCCTGGGTGTGGGGCAGG + Intronic
1102347494 12:112169214-112169236 AAGGGCCCTGGCTGAGGAGTTGG - Intronic
1103773120 12:123344225-123344247 CCCTGACCTGGCTGAGGTGCAGG - Intronic
1103828673 12:123762046-123762068 CACGCCCCTGGATGCGGAGCGGG - Intergenic
1106956325 13:34942658-34942680 AGCGGGCCGGGCTGAGGCGCAGG + Exonic
1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG + Intergenic
1113930098 13:113963631-113963653 GACGGGCGAGGCTGAGGAGAGGG - Intergenic
1114161685 14:20175239-20175261 CTCTGGGCTGGCTGAGGAGGGGG + Intergenic
1114570571 14:23664565-23664587 GTCGGCCATGGCTGAGGAGCAGG + Intergenic
1115641623 14:35339029-35339051 CAAGGCCCTCGCTGAGGGGCTGG - Intergenic
1115855091 14:37622364-37622386 CTCGGGCCTGGGTGAGGCGGCGG + Intronic
1116068536 14:40013286-40013308 CACAGGCCTAGGAGAGGAGCAGG - Intergenic
1118349813 14:64965735-64965757 CACCAGCCTGTCTGGGGAGCGGG + Intronic
1119998598 14:79279058-79279080 CACGCGCCTGGGAGAAGAGCAGG + Intronic
1122049785 14:99048485-99048507 CAGAGGCCTCCCTGAGGAGCTGG + Intergenic
1122479901 14:102040317-102040339 CCAGGGCCTGACTGTGGAGCAGG + Exonic
1122895107 14:104752930-104752952 CAGGGGCCAGGTTGAGGATCAGG - Intergenic
1124373274 15:29115390-29115412 CAGGGGTCTGGCTCAGGAGGAGG + Intronic
1125891553 15:43270591-43270613 TACGGTCCAGGCAGAGGAGCTGG - Intergenic
1127567282 15:60203929-60203951 CAATGGCCTGACTCAGGAGCAGG + Intergenic
1128063059 15:64747411-64747433 CTGGGACCTGGCTGGGGAGCAGG - Intronic
1128599104 15:68980479-68980501 GAAGGGCCTGGGAGAGGAGCAGG + Intronic
1128797938 15:70478619-70478641 CGGGTGCCTGGCTGAGGAGCCGG - Intergenic
1129333942 15:74841499-74841521 CAGGGCGCTAGCTGAGGAGCAGG + Exonic
1129966717 15:79742799-79742821 CCCGGGCCTGGAAGATGAGCAGG - Intergenic
1130150982 15:81311463-81311485 CAGAGCCCTGGATGAGGAGCTGG - Exonic
1130430388 15:83841721-83841743 CACTGGCCTGGGTGAGGACAGGG + Intronic
1131114218 15:89784254-89784276 GATGGGCTGGGCTGAGGAGCAGG - Intergenic
1131471908 15:92704824-92704846 CACAGACCTGGCTGAGGTGGTGG - Intronic
1132029803 15:98430311-98430333 CAGGGCCCTGCCTGAGGGGCTGG + Intergenic
1132869941 16:2111491-2111513 CATGAGCCTGGCCGTGGAGCAGG - Exonic
1132978026 16:2720164-2720186 CTCAGGCCTGGCTGGGGCGCAGG + Exonic
1133231581 16:4369519-4369541 CTGGGACCTGGCTGAGGGGCGGG - Intronic
1134296883 16:12954180-12954202 GAAGGGCATGGCTGAGCAGCAGG + Intronic
1134717481 16:16364110-16364132 CATGAGCCTGGCCGTGGAGCAGG + Intergenic
1134957271 16:18388049-18388071 CATGAGCCTGGCCGTGGAGCAGG - Intergenic
1135004016 16:18802028-18802050 CAGGGGCCTGGCTGGGGAACTGG - Intergenic
1135326312 16:21527949-21527971 CCCGGGCCTGGTTCAGGAGCGGG + Intergenic
1135569156 16:23535053-23535075 CCAGGGCCTGGTAGAGGAGCAGG + Exonic
1136016494 16:27404194-27404216 CACCCTCCTGGCAGAGGAGCGGG - Intronic
1136070552 16:27784617-27784639 CACAGGCCTGGCAGGGGAGTGGG - Intergenic
1136157350 16:28392039-28392061 CAAGCGCCTGGATGAGGAGGAGG - Exonic
1136205737 16:28723245-28723267 CAAGCGCCTGGATGAGGAGGAGG + Exonic
1136247616 16:28984765-28984787 CACAGGCCTGGCTGAGGTGGGGG + Intergenic
1137734197 16:50712008-50712030 CACAGGCCTGGCGCCGGAGCAGG - Exonic
1138218030 16:55222636-55222658 GAGGGGCCTGGTGGAGGAGCAGG + Intergenic
1138563905 16:57818648-57818670 CACCAGCCTGGCTGAGTGGCAGG + Intronic
1139432412 16:66918229-66918251 GGTGGGCCTGGCCGAGGAGCAGG - Intronic
1139435070 16:66932191-66932213 CAAAGGCCAGGCTCAGGAGCGGG + Exonic
1139517451 16:67460173-67460195 CCTGGGCCTGGCTGAGAAGTCGG + Intronic
1139779511 16:69339336-69339358 CGAGCGCCTGGCGGAGGAGCGGG - Exonic
1139953108 16:70681360-70681382 CAGGGGCCTGGCAGGGGATCTGG + Intronic
1140118255 16:72061437-72061459 CATGGGCCTGGTTGAGGAAGAGG + Intronic
1140296076 16:73710945-73710967 CCCTGGCCTTGCTGAGTAGCAGG - Intergenic
1141080122 16:81043460-81043482 CACAGGCTGGGCTGAGGAGTCGG - Exonic
1141357569 16:83362813-83362835 CACAGCCTTGGCTGGGGAGCAGG - Intronic
1141370302 16:83480394-83480416 CAGTGGCCCGGCTGAGGACCTGG - Intronic
1141743269 16:85908668-85908690 CCCTTGCCTGGCTGAAGAGCTGG - Intronic
1141961657 16:87413107-87413129 CATGGGGCTGGAGGAGGAGCTGG + Exonic
1142039361 16:87882677-87882699 CCCGGGCCTGGTTCAGGAGCGGG + Exonic
1142237543 16:88929344-88929366 CACGGGCCTGCGGGAGGACCCGG + Intronic
1142263004 16:89051270-89051292 CCCGGGCTGGGCTGAGGGGCAGG - Intergenic
1143013271 17:3878084-3878106 CACAGACCTTGCTGATGAGCAGG - Intronic
1143485757 17:7252636-7252658 TTCGGGCCTGGCTGAGGGGACGG + Intronic
1143908474 17:10228252-10228274 CAAGCGCCTGGCTCAGTAGCAGG - Intergenic
1144807864 17:17979466-17979488 CACAGGCCTGGCCGAGGTGGTGG + Intronic
1144833014 17:18142219-18142241 CACGGGCCCGGCTTTGCAGCAGG - Exonic
1145910431 17:28539053-28539075 CACTGGGGAGGCTGAGGAGCAGG + Intronic
1146274780 17:31509725-31509747 CCCGGGGCTGGCTGAGGTGTGGG + Intronic
1146339674 17:32007863-32007885 CACGGGCCCGGCGGGGGCGCGGG + Intronic
1147250785 17:39151526-39151548 CCCGGGGCTGGCGGAGGGGCGGG + Exonic
1147339890 17:39746985-39747007 CAGGGGACGGGATGAGGAGCGGG + Exonic
1147418963 17:40312537-40312559 CACGGGGCAGGCAGAGGGGCTGG + Intronic
1147467145 17:40619175-40619197 CAAGGGCCGGGCTGAGGGGCAGG - Intergenic
1148085942 17:44993883-44993905 GAAGGGCCTGGCGGATGAGCAGG + Intergenic
1148177378 17:45578969-45578991 TTCGAGCCTGGCTAAGGAGCAGG + Intergenic
1148859542 17:50596830-50596852 CACGGGCCTGGGCGAGGCGCTGG + Exonic
1150656235 17:67041650-67041672 AACGGGCCTGGCTGCGGAGCAGG - Intergenic
1151743717 17:76000794-76000816 CACGGGCCGGGCTGAGGCCCTGG + Intronic
1152310205 17:79545394-79545416 AAACAGCCTGGCTGAGGAGCCGG + Intergenic
1152312201 17:79558254-79558276 GAGGGGCCTGGCGCAGGAGCAGG + Intergenic
1152701943 17:81823692-81823714 GACAGGCCTGCCAGAGGAGCGGG - Intronic
1152715713 17:81899608-81899630 CAGGGGCCTCTCTGAGGAGGTGG - Intronic
1152945758 17:83196598-83196620 CGGGGGCCTGGGTGAGGACCTGG + Intergenic
1153339604 18:3960780-3960802 AGGGGGCCTGGCTGGGGAGCAGG - Intronic
1153808871 18:8734429-8734451 CACGGGGATGGCTCCGGAGCAGG - Intronic
1154034473 18:10786127-10786149 CACGGGCTTTGCTGAGGAGCTGG - Intronic
1156403547 18:36761621-36761643 AACGGGACAGGCAGAGGAGCGGG - Intronic
1156625584 18:38903673-38903695 CACTGAACTAGCTGAGGAGCAGG - Intergenic
1157808581 18:50677177-50677199 CACGGACCGGGAAGAGGAGCTGG - Intronic
1158505573 18:58044115-58044137 CACAGGCCGGGCTGGCGAGCGGG - Intergenic
1159098808 18:63936619-63936641 CACGGGGTTGGCTGAGGGGATGG + Intergenic
1160862121 19:1241889-1241911 CACGGGCGTGGCGGACGAGGCGG - Exonic
1161026525 19:2039759-2039781 CGAGGACCTGGCTGAGGAGGAGG - Exonic
1161068890 19:2250812-2250834 CACGCGGCTGGCTCAGGGGCTGG - Intronic
1161115251 19:2493128-2493150 CCCGTGCCTGTCTGAGGAGGTGG - Intergenic
1161323030 19:3649995-3650017 CGCTGGCCTGGCGGGGGAGCAGG - Intronic
1161357340 19:3826304-3826326 GAGAGGCCTGGCTGAGGACCTGG - Intronic
1161704002 19:5809613-5809635 CCAGGGCCTGGCTGGGGACCAGG - Intergenic
1161818850 19:6516787-6516809 CGCGGGGCTGGCTGGGGTGCGGG + Intergenic
1162324843 19:9993022-9993044 CACTGGCCAGGCTGGGGAGCCGG - Exonic
1163298696 19:16429672-16429694 CATCTGCCAGGCTGAGGAGCAGG - Intronic
1163429409 19:17258168-17258190 AACTGGCCTGGTTGAGGAGTGGG - Intronic
1163441584 19:17324747-17324769 CGAGGCCCTGGCTGAGGAGCTGG - Exonic
1163833868 19:19561879-19561901 CACGGGCCTGGCTGAGGAGCAGG + Exonic
1164769690 19:30799184-30799206 CAGGGGCCAGGCTGGGGAGAAGG - Intergenic
1165356116 19:35305165-35305187 CACAGGCCTGGGTGAAGAGTAGG - Intronic
1165565088 19:36718814-36718836 CACTGGCCTGGCAGGGGTGCGGG - Intronic
1165709257 19:37998284-37998306 CACAGGGCTGGCTGAGGAACAGG - Intronic
1165745625 19:38228521-38228543 CCCGGGCCTGGTGGAGGAGGCGG - Intronic
1166573332 19:43813584-43813606 CATGGGGCTGGCTGAGGAGATGG + Intronic
1166876643 19:45901842-45901864 CACGGGGCTGGCTGGGGTTCGGG + Intronic
1166947913 19:46408532-46408554 ACCTGGCCTGCCTGAGGAGCTGG - Intergenic
1167116879 19:47493574-47493596 CACAGGCGTGGCTGAGGGGTGGG - Intronic
1167373519 19:49098944-49098966 GACCTGCCTGGCTGAGCAGCAGG - Intronic
1167420338 19:49399049-49399071 CAAGGCCATGGATGAGGAGCTGG + Exonic
1167435522 19:49476385-49476407 CACGGGTCTGAGGGAGGAGCTGG - Intronic
1167782861 19:51611728-51611750 CAAGTGCCAGGCTGAGGGGCTGG + Intergenic
1168318496 19:55494598-55494620 CAGGGGCATGCCTGTGGAGCAGG - Exonic
1168648430 19:58076847-58076869 CTGGGGCCTTGGTGAGGAGCTGG + Intronic
1202713049 1_KI270714v1_random:27901-27923 CAGGCGCCTGGCTGAGGCTCTGG - Intergenic
925029208 2:636499-636521 CACCGGCCCCTCTGAGGAGCAGG + Intergenic
925032342 2:660762-660784 CTGCGGCCTGGCTGAGGAGCAGG - Intergenic
926123352 2:10256538-10256560 CAGGGGCCTGGGGGAGAAGCAGG + Intergenic
926334843 2:11855381-11855403 CAGGGCCCTGGCTGGGGAGGTGG + Intergenic
927518894 2:23687632-23687654 CAAGGGCCTGGCTGTGGGGGAGG + Intronic
927856319 2:26530034-26530056 CAGCGCCCTGGCTGATGAGCTGG - Intronic
927882536 2:26698737-26698759 ACCAGGCATGGCTGAGGAGCGGG - Intronic
928090228 2:28369291-28369313 CACAGCCCAGGCAGAGGAGCAGG - Intergenic
931711096 2:64989494-64989516 TCCGGGCCTGGCGCAGGAGCAGG - Exonic
932669947 2:73728608-73728630 CACGGACCTGCCTCAGCAGCTGG + Intergenic
932769126 2:74490661-74490683 CAATCGCCTGGCTGAGGAGCTGG + Exonic
934580621 2:95434714-95434736 CAGGGGCCTAGCTGAGGGGAGGG + Intergenic
934598830 2:95642003-95642025 CAGGGGCCTAGCTGAGGGGAGGG - Intergenic
934673273 2:96230690-96230712 CACGTGCTTAGCTGGGGAGCAGG + Intergenic
934714027 2:96532966-96532988 CAAGGCCTTGGCTGAGTAGCTGG + Intergenic
936523969 2:113230325-113230347 CTCGAGCCTGGCAGAGTAGCAGG + Intronic
936532177 2:113283996-113284018 CAGGGGCCTAGCTGAGGGGAGGG - Intergenic
936913435 2:117615590-117615612 TAGGGCCCTGGCAGAGGAGCAGG + Intergenic
937292646 2:120790830-120790852 CACAGGCAGGTCTGAGGAGCTGG + Intronic
937854077 2:126660218-126660240 CACAGGCCCGGCTGAGGAGCTGG - Intronic
938260427 2:129891963-129891985 CACGGGCCAGGCTGAGGCTGAGG - Intergenic
938463294 2:131511469-131511491 CCCTGGCCTGGCTGCGGAGGCGG + Intergenic
941615365 2:167712511-167712533 CATGGGCCAAGCTGAGGATCAGG - Intergenic
941905733 2:170715478-170715500 CAGGCCCCTGGCTGCGGAGCGGG - Exonic
944241155 2:197486329-197486351 CAAAGGCCATGCTGAGGAGCTGG + Intergenic
944448792 2:199819740-199819762 CACAGGCCTTGCTGAGGATCTGG - Exonic
946280484 2:218662510-218662532 CACAGCCCTGGCTGGGGAACTGG + Exonic
946921413 2:224585123-224585145 CCCGGGCAGGGCTGGGGAGCTGG + Exonic
947230836 2:227884810-227884832 CAATGGCCTGGCTGTGGAGTGGG + Intronic
947341937 2:229149807-229149829 CACAGGCCTAGGTGAGGGGCTGG + Intronic
947495361 2:230632288-230632310 CTCAGGCCTGTCTGGGGAGCGGG - Intergenic
948603218 2:239119293-239119315 CAATGCCCTGGATGAGGAGCAGG + Intronic
948668951 2:239554174-239554196 CACCTGCCTGGCTGAGAAACAGG + Intergenic
948725139 2:239929855-239929877 AGCAGGGCTGGCTGAGGAGCAGG - Intronic
948725172 2:239929974-239929996 AGCAGGACTGGCTGAGGAGCAGG - Intronic
948725197 2:239930076-239930098 AGCAGGACTGGCTGAGGAGCAGG - Intronic
948725231 2:239930212-239930234 AGCAGGGCTGGCTGAGGAGCAGG - Intronic
1168760532 20:347212-347234 CACGGCCCGGGCTGAGGATGCGG - Intronic
1168836107 20:878374-878396 CATGTCCCTGGCTGAGGAGCTGG + Intronic
1169019777 20:2321008-2321030 CAGGGGCTTGGCTGAGGTGTGGG - Intronic
1169068615 20:2708184-2708206 CACAGCGCTGGCTGAGGAGAGGG + Intronic
1169496718 20:6122845-6122867 CCCGGGCCGAGCCGAGGAGCGGG + Exonic
1169715099 20:8607139-8607161 AACAGGCCTGGCTGAGGAATGGG - Intronic
1170867111 20:20167903-20167925 CAGGGACCTGGCAGAGGATCAGG + Intronic
1170916265 20:20628958-20628980 CACGGAGCTCTCTGAGGAGCTGG - Intronic
1171420282 20:25013264-25013286 CATGGGCCTGGCTGCAGTGCAGG + Intronic
1172307021 20:33888104-33888126 CACAGCCCTGGAGGAGGAGCAGG - Intergenic
1172486090 20:35298570-35298592 CAAGGGCCTGGCTTTGGAGGTGG - Intergenic
1172634585 20:36401371-36401393 GACAGTCCTGGCTGAGGAGGGGG + Intronic
1174035291 20:47665000-47665022 CGCCAGCCTGGCTGAGGAGCAGG + Intronic
1175108857 20:56631630-56631652 CGCGGGCCTGGCCGAGAACCTGG + Exonic
1176066230 20:63197474-63197496 CACTGGCCTCCCTGAGTAGCAGG + Intronic
1176093208 20:63328108-63328130 CACAGGCCTGGCTCACAAGCTGG - Exonic
1176387264 21:6144769-6144791 CACGGACATGGCCGAGCAGCTGG + Intergenic
1176511838 21:7754637-7754659 CAAGGGCCTGGGTGATCAGCAGG + Intronic
1178645951 21:34385163-34385185 CAAGGGCCTGGGTGATCAGCAGG + Intronic
1179611248 21:42552773-42552795 CACGTTCCTGGCTGAAAAGCAGG + Intronic
1179736209 21:43393479-43393501 CACGGACATGGCCGAGCAGCTGG - Intergenic
1180085506 21:45506339-45506361 CACGGCCCCGGCTGGGGGGCAGG + Intronic
1180920729 22:19520215-19520237 CAGGGGGCTGGCTGAGCAGCTGG + Intronic
1181100696 22:20536977-20536999 CACCAGCCTGGCTGAGGTCCAGG - Intronic
1181109371 22:20592239-20592261 AAGGGGCGTGGCTGAGGAGCAGG + Intergenic
1182757030 22:32688669-32688691 CAAGGCTCTGCCTGAGGAGCAGG - Intronic
1183267598 22:36838840-36838862 CAGAGGCCAGGCTGAGCAGCTGG + Intergenic
1184067848 22:42130392-42130414 CAAGGGCCTGGAGGTGGAGCTGG - Intronic
1184070583 22:42144064-42144086 CAAGGGCCTGGAGGTGGAGCTGG - Intergenic
1184072475 22:42154624-42154646 CAAGGGCCTGGAGGTGGAGCTGG - Intergenic
1184242988 22:43221203-43221225 CTCGTGCCTGGCTGTGGGGCCGG + Exonic
1184361617 22:44022516-44022538 CACGCCCCTGGCTGAGGACTGGG + Intronic
1184550839 22:45203394-45203416 CACGGACCAGGCTGAGGACAGGG + Intronic
1185214238 22:49589494-49589516 CACGGGTCTTGGTGAGGAACGGG - Intronic
1185344146 22:50304142-50304164 GGCTGGCCTGGCTGTGGAGCTGG - Intronic
949498528 3:4656119-4656141 CAGAAGCCTGGCAGAGGAGCGGG - Intronic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
950221035 3:11196252-11196274 CAAAGCCCCGGCTGAGGAGCCGG - Intronic
952155000 3:30633562-30633584 CAGGGGCCTGGCAGGGGAGTAGG + Intronic
953344119 3:42160668-42160690 CAAGGGACTTCCTGAGGAGCTGG - Intronic
954284814 3:49611438-49611460 CCTGGGGCTGGCTGGGGAGCAGG + Intronic
955209662 3:56928894-56928916 CACGGGCCTCAGTGAGGAGGTGG + Intronic
961592589 3:127991765-127991787 CACGCTCCAGGCTGAGAAGCTGG + Intergenic
961744708 3:129057102-129057124 CATGGGCCAGGCAGAGGTGCTGG + Intergenic
962177188 3:133167423-133167445 CATGGGACTGGCTGCAGAGCAGG + Intronic
963089706 3:141471698-141471720 CAGGGGCCTGGCTGCGGGGATGG - Intergenic
967018093 3:185499106-185499128 CGGGGGCCTGGCTCAGGAGGTGG - Intergenic
967089338 3:186121955-186121977 CACAGACCTGGCTGAAGAGATGG + Intronic
967791913 3:193559034-193559056 CACGGCCCTGGCAGAGAAACCGG - Intronic
968493065 4:900863-900885 CTGGGGCATGGCTCAGGAGCAGG + Intronic
968641813 4:1718561-1718583 CAGGGGCCTGGCTGAGGGCGTGG + Exonic
968704050 4:2069892-2069914 CAGGGGACCGGCTGTGGAGCTGG - Intergenic
968756397 4:2418379-2418401 CCCGGGCCCGGCTGAGGCGCGGG + Exonic
979785608 4:124712577-124712599 CCCGGGCCCGGCGGAGGAGGCGG - Exonic
982070553 4:151690649-151690671 CACAGGCTTGGCTGAGTTGCTGG + Intronic
984708156 4:182862826-182862848 CTCAGGCCTGGCAGAGGAGGTGG - Intergenic
985198690 4:187461631-187461653 CACGGGCAGCCCTGAGGAGCTGG - Intergenic
985489500 5:171165-171187 CTCCGGCCTGGCTGAGGGCCGGG - Intronic
985533201 5:445777-445799 CACAGGCCTGGCCAAGGTGCTGG + Intronic
985947095 5:3194246-3194268 CATGGCTGTGGCTGAGGAGCTGG - Intergenic
988560843 5:32279710-32279732 CACGGACCTGGCAGGGGGGCAGG + Intronic
988832687 5:35003110-35003132 CAGGGTCCTGACTGTGGAGCTGG + Intronic
990868827 5:60408990-60409012 CACTGGGCTGGCAGAGGACCTGG - Intronic
991690221 5:69218140-69218162 CAAGGTCCTGGCGGAGGAGCGGG - Intronic
997453975 5:134004478-134004500 CGCGGGCCTGGCTGGTGAGCGGG - Intronic
999180156 5:149664520-149664542 GAGGGGCCTGGCTGGGGAGAGGG + Intergenic
1000356382 5:160400015-160400037 CCCGGGCCTGGCTGAGGCGGAGG - Exonic
1000834302 5:166135360-166135382 CACGGGCCTTGCCTAGGAGCAGG + Intergenic
1001122368 5:168991389-168991411 CACCTGCCTGGCTGGGAAGCAGG + Intronic
1001562476 5:172678488-172678510 AATGGGGCTGGCTGAGGAGCAGG - Intronic
1002061646 5:176629322-176629344 CACGGGGCGGGCTGATGAGGTGG - Intronic
1004018942 6:11758971-11758993 CACGGGCCTGGAACATGAGCAGG - Intronic
1004057910 6:12159513-12159535 CTCCGCCCTGGCTGAGGAGAAGG - Intronic
1004357755 6:14944845-14944867 CACTCACCTGGCTGGGGAGCAGG + Intergenic
1005939269 6:30548559-30548581 AACGGGCCTGGCTGAGGAGCTGG - Intronic
1006393316 6:33771606-33771628 CAGGGAGCAGGCTGAGGAGCTGG + Exonic
1006472794 6:34237704-34237726 CCCGGGCCCGGGTGAGGGGCGGG + Intronic
1006509677 6:34515183-34515205 CAGGGACCAGGCTGGGGAGCGGG + Intronic
1006941361 6:37753964-37753986 CGCGGGCCTGGCCAGGGAGCGGG + Intergenic
1007427993 6:41759579-41759601 CCAGGGCCTGGATAAGGAGCAGG + Intergenic
1008597159 6:53054119-53054141 CTGGGGCCTGGCTGAGGCACTGG - Intronic
1018217927 6:161548918-161548940 CCCCGCCCTGGCTGTGGAGCGGG - Exonic
1018447141 6:163868051-163868073 CAGGGGCCTGGGTGAGGAGCTGG + Intergenic
1019138419 6:169927158-169927180 CAGGGGCCGGGCTGAGGACCTGG + Intergenic
1019374830 7:683829-683851 CATCGGGCTGGGTGAGGAGCGGG - Intronic
1019508764 7:1406655-1406677 CAAGGGGCTGCCTGAGGGGCTGG + Intergenic
1019765155 7:2844334-2844356 CTCGGGCCCGGCGGAGGGGCGGG + Intergenic
1020119683 7:5496025-5496047 CAAGGGCCTTCCTCAGGAGCAGG - Intronic
1023530631 7:41149801-41149823 CACGGGAATGGCAGAGGAGCAGG - Intergenic
1023821921 7:43985409-43985431 CAGGTGCCTAGCTGAGGAACTGG - Intergenic
1025085832 7:56022574-56022596 CAGGGGCCTGGCTGTGCATCAGG + Intronic
1025941386 7:66078182-66078204 CAGGCTCCTGGCTGAGGGGCAGG + Intronic
1026688293 7:72531484-72531506 CCTGGGCCTGGTTGAGGGGCAGG - Intergenic
1027243753 7:76351523-76351545 CACGAACCTGGCTGCAGAGCAGG + Intronic
1029402181 7:100353260-100353282 CACGAGCATGGGTGAGGAGGGGG + Exonic
1029750186 7:102538831-102538853 CAGGTGCCTAGCTGAGGAACTGG - Intronic
1029768137 7:102637939-102637961 CAGGTGCCTAGCTGAGGAACTGG - Intronic
1033036745 7:137882548-137882570 CCCGGGCTCGGCTGGGGAGCTGG - Exonic
1033137619 7:138798137-138798159 CAAAGGCCAGGCTGAGGATCAGG - Exonic
1033540779 7:142353711-142353733 TTCGGGCATGGCTGAGGAACAGG + Intergenic
1034285342 7:149880186-149880208 GGCGGGGCTGGCTCAGGAGCAGG - Exonic
1034417977 7:150975147-150975169 CGCGGGCCAGGCGGAGGAGGGGG - Intronic
1035187544 7:157138565-157138587 CACGGGCCGGGATGGGGTGCAGG - Intergenic
1035777912 8:2203636-2203658 GACGGCAGTGGCTGAGGAGCTGG + Intergenic
1036163670 8:6411173-6411195 CACAGGCCTGGTTGAAGAGTTGG + Intronic
1037273781 8:17156663-17156685 CGCGGGCCTGGCTCCGGGGCGGG - Exonic
1038112573 8:24515767-24515789 CATGGCCCAGGCTGAAGAGCAGG + Intronic
1039988413 8:42467455-42467477 AAAGGGCCTGGCTGATAAGCTGG + Intronic
1040562464 8:48536136-48536158 CCCAGGCCTGGCTGATGAGGTGG - Intergenic
1041124457 8:54621337-54621359 CGCGGCCCTGGCTCAGCAGCCGG + Exonic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042554028 8:70019232-70019254 CACAGGGGTGGCTGAGGTGCTGG + Intergenic
1044760209 8:95509965-95509987 AATGGGCTGGGCTGAGGAGCAGG + Intergenic
1045391668 8:101721296-101721318 CAAGGGCCTGACTGTGTAGCAGG - Intronic
1047304758 8:123643679-123643701 CAGTGTCCAGGCTGAGGAGCAGG + Intergenic
1048607246 8:135982419-135982441 CATGGACCTGGGTGAGGAGTGGG - Intergenic
1048816670 8:138340650-138340672 TATGTGCCAGGCTGAGGAGCTGG - Intronic
1048981184 8:139703955-139703977 CGCGGGCCTCGCGGAGCAGCGGG + Intergenic
1049095047 8:140543832-140543854 CACGGGCCTGTCTGGGGTTCGGG + Intronic
1049293313 8:141815713-141815735 CACTGATCTGGCTAAGGAGCTGG + Intergenic
1049426476 8:142540182-142540204 GACAGCCCTGGCAGAGGAGCTGG + Intronic
1050564875 9:6871742-6871764 TTAGGGCCTGGCTGTGGAGCAGG + Intronic
1051894181 9:21970995-21971017 CGTGGACCTGGCTGAGGAGCTGG - Exonic
1053000500 9:34574884-34574906 GATGGGCCTGGCTGGGCAGCTGG + Intronic
1057186156 9:93058649-93058671 CCTGGGCCTGGGTGAGGGGCGGG - Intergenic
1057463893 9:95293298-95293320 CACAGGCTGGGCTGAGGAGTCGG - Intronic
1057934044 9:99221879-99221901 CAGGGCCATGGCGGAGGAGCAGG - Exonic
1059102335 9:111483345-111483367 CCCGGGCCTGGCGGACGGGCGGG - Intronic
1060532828 9:124358240-124358262 CATGGGGCAGGCAGAGGAGCAGG - Intronic
1060759654 9:126236454-126236476 CCCGGGCCTGGCTGAGCTGGGGG - Intergenic
1060814060 9:126625664-126625686 CACGGGCCTGGCGGAGAAGAGGG - Intronic
1060816466 9:126637996-126638018 CCCGGGCAGGGCTGCGGAGCGGG - Intronic
1060971357 9:127739974-127739996 AACGGGCCTGGCTGAGGTCCGGG + Intronic
1061192344 9:129089180-129089202 CAGGGTCCTGGTTGAGGGGCTGG - Exonic
1061289245 9:129641579-129641601 CCCCGGCGTGGCAGAGGAGCAGG - Intronic
1062265917 9:135686411-135686433 CAGGTGCCTTTCTGAGGAGCAGG - Intergenic
1062376003 9:136262200-136262222 GACGAGCCTGGCTCAGGGGCCGG - Intergenic
1062587470 9:137255671-137255693 GTCGGGCCTGGCGGAGGCGCCGG + Intronic
1203747979 Un_GL000218v1:54094-54116 CACGGGCCGCCCTGAGCAGCGGG - Intergenic
1185453484 X:295444-295466 CACGGGCCGGGCAAAGGAGCAGG + Intronic
1186660725 X:11665357-11665379 CAGGCGCCCGGCTCAGGAGCGGG - Exonic
1187927661 X:24264715-24264737 CACTGGCCTGGGATAGGAGCTGG - Intergenic
1189005965 X:36995198-36995220 CAGGGGGCTGGATGAGGAACTGG + Intergenic
1189327705 X:40122923-40122945 CCCGGGCCTGCCTGACGAGCGGG + Intronic
1189537721 X:41953837-41953859 CAAGGGCATTGCTGAGAAGCAGG + Intergenic
1196277185 X:113780370-113780392 CACTCGCCTGGCTGAAGGGCTGG + Intergenic
1197229262 X:123985823-123985845 CAAGAGGCTGGCTGTGGAGCAGG - Intronic
1197894039 X:131292097-131292119 CCTGGGACTGGCTGAGGAGTGGG - Intronic
1198312257 X:135434723-135434745 CTCAGGCCTGGCCAAGGAGCTGG + Intergenic
1199803414 X:151273356-151273378 CAAGGGCCTGGCTGAGGTTTGGG + Intergenic
1202115152 Y:21465062-21465084 CATAGGCCTGGCTGATGATCTGG + Intergenic
1202378412 Y:24257743-24257765 CTCAGCTCTGGCTGAGGAGCTGG - Intergenic
1202492370 Y:25412378-25412400 CTCAGCTCTGGCTGAGGAGCTGG + Intergenic