ID: 1163834006

View in Genome Browser
Species Human (GRCh38)
Location 19:19562478-19562500
Sequence TGAGACTCGGTGGGAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163833996_1163834006 4 Left 1163833996 19:19562451-19562473 CCCATGATGACGCCCGGAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 224
1163833994_1163834006 11 Left 1163833994 19:19562444-19562466 CCTGGAGCCCATGATGACGCCCG 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 224
1163833997_1163834006 3 Left 1163833997 19:19562452-19562474 CCATGATGACGCCCGGAGCGTCA 0: 1
1: 0
2: 0
3: 4
4: 20
Right 1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 224
1163834000_1163834006 -9 Left 1163834000 19:19562464-19562486 CCGGAGCGTCATGGTGAGACTCG 0: 1
1: 0
2: 1
3: 83
4: 2371
Right 1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 224
1163833999_1163834006 -8 Left 1163833999 19:19562463-19562485 CCCGGAGCGTCATGGTGAGACTC 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163834006 Original CRISPR TGAGACTCGGTGGGAAAAAG GGG Intronic
902772639 1:18654531-18654553 TGCCACTCGCTGGGAAGAAGTGG - Intronic
904496353 1:30888971-30888993 TGAGGCTCTGTGGGACACAGTGG + Intronic
904717688 1:32481421-32481443 TGGGGCTCGGTGGGAAACTGAGG - Intronic
904856780 1:33503778-33503800 TGAGGCTCTGTGGTAAAATGGGG - Intergenic
907506218 1:54920418-54920440 GGGGACTAGGTGGGACAAAGTGG - Intergenic
907964233 1:59313793-59313815 GGGGACTCAGTGGGAAAGAGCGG + Intronic
908676545 1:66610971-66610993 GGAAACTCGGTGGGAAAGGGTGG + Intronic
909237671 1:73174647-73174669 TGAGATTAGGTAGGAGAAAGAGG - Intergenic
909936108 1:81552901-81552923 TGACACACTGGGGGAAAAAGTGG - Intronic
910353589 1:86328897-86328919 TGAGACTGGGTGAAGAAAAGAGG + Intergenic
910657233 1:89632211-89632233 TGAAATTGGGTGGGAAAATGGGG + Intergenic
913445634 1:118947755-118947777 TGAGACTCGGTGAAGCAAAGTGG + Intronic
914733993 1:150398553-150398575 TGAGACTCTGTCAGAAAAAAGGG - Intronic
917721153 1:177787733-177787755 TTGGATTTGGTGGGAAAAAGGGG + Intergenic
920278515 1:204826359-204826381 GGAGACAGGGTGGGAAGAAGAGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921632685 1:217454630-217454652 TGAGACTCTGTCTCAAAAAGGGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924858791 1:247900185-247900207 TGAACCTCGCTGGGAAAAAGAGG - Intergenic
1063218082 10:3942074-3942096 TGAGACTCTGTGGAAAAAAAAGG + Intergenic
1064681204 10:17812310-17812332 TGAGAGCCGGTGGGACACAGAGG + Intronic
1067220477 10:44340560-44340582 TGAGACTCACTGGTAAAAAATGG + Intergenic
1067554386 10:47258130-47258152 TGTGACTGGGTGGGAAAATGGGG + Intergenic
1068671531 10:59728325-59728347 TGATCCTCGCTGGAAAAAAGGGG - Intronic
1071334616 10:84590490-84590512 GGAGACTGGGGAGGAAAAAGCGG - Intergenic
1072189151 10:93066410-93066432 TGAGGCTCTGAGGGCAAAAGAGG - Intronic
1072656365 10:97333319-97333341 ACCGAATCGGTGGGAAAAAGGGG + Exonic
1079317176 11:19418662-19418684 TGAGACGGGGTTGGAAAAAGAGG + Intronic
1079408048 11:20162527-20162549 TAAGACTCGGGGAGAAAAAGGGG - Intergenic
1079564496 11:21864988-21865010 TGAGACTCTGTCTCAAAAAGAGG - Intergenic
1079612231 11:22447472-22447494 TGAGACTAGGAAGAAAAAAGAGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080892797 11:36424075-36424097 TGAGTCTCCGTGGAAAAAAATGG + Intronic
1081473465 11:43400017-43400039 TGAGACTCAGATGGCAAAAGAGG + Exonic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083081956 11:60103243-60103265 TGATCCTCGCTGGAAAAAAGAGG - Intergenic
1086415263 11:86582852-86582874 TCAGACTCGGTGGAAACAACTGG - Intronic
1086577636 11:88358631-88358653 AAAGACTTGGTGAGAAAAAGTGG - Intergenic
1086973181 11:93105392-93105414 TGATCCTCGCTGGAAAAAAGGGG - Intergenic
1087684792 11:101250423-101250445 TGATCCTCGCTGGAAAAAAGGGG + Intergenic
1088433383 11:109783035-109783057 TGAGACCCTGTGGGAAGCAGGGG - Intergenic
1089899712 11:121967777-121967799 AAAGACTCTGTGGGAAGAAGTGG - Intergenic
1091615191 12:2045645-2045667 TGAGCCTCAGTGAGAGAAAGAGG + Intronic
1092485589 12:8899916-8899938 TGAGACTGGGAAGAAAAAAGAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094297743 12:28926945-28926967 TGAGACTGGGAAGAAAAAAGAGG - Intergenic
1096481132 12:51941764-51941786 TGGCACTCGGTGTGAAGAAGGGG + Intergenic
1096709584 12:53445389-53445411 TGAGATTTAGTGGGGAAAAGCGG + Intronic
1097087122 12:56476999-56477021 TGAGTCTGGGTGAGGAAAAGAGG - Exonic
1098455873 12:70672509-70672531 TGAGACATGATGGGAAACAGTGG + Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1100514342 12:95312536-95312558 TGAGACTCGGTAAGAAAAGGTGG + Intergenic
1100782805 12:98047473-98047495 TGAGACTGGGGGAAAAAAAGAGG + Intergenic
1101116211 12:101533921-101533943 AGAGACTCAGTGTGAAAAGGAGG - Intergenic
1102703755 12:114863342-114863364 TGAGACGCGGTGGGACAAGGAGG + Intergenic
1103617672 12:122165049-122165071 TGAGAATCTGTGGGGAAAACAGG + Intergenic
1104915427 12:132261975-132261997 TGAGCCTCTGTGGGCAAGAGAGG + Intronic
1106224463 13:27774596-27774618 TGAGACTCACTGGGAAGAGGTGG - Intergenic
1110303304 13:73954645-73954667 AGAGTGTTGGTGGGAAAAAGAGG - Intronic
1111900557 13:94194589-94194611 GGAGACTCGGAGGGAAAGGGTGG + Intronic
1115118494 14:29910690-29910712 TGAGACTTGTTAGGACAAAGAGG + Intronic
1118751678 14:68812272-68812294 TGAGACTGGGTGGGTACACGGGG + Intergenic
1119175040 14:72562612-72562634 GGAGACTCGGTGGGTGAATGGGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119507661 14:75186872-75186894 TGAGACTCTATGGGAGAAAGAGG + Intergenic
1120909807 14:89656057-89656079 TGAGACTGGGAAGAAAAAAGAGG - Intergenic
1127344320 15:58079019-58079041 GGAGACTCTGGGGGAAGAAGAGG - Intronic
1127653612 15:61034233-61034255 TGAAACTAAGGGGGAAAAAGAGG + Intronic
1130557747 15:84934880-84934902 TGAGACCCAGAGAGAAAAAGGGG - Intronic
1131234009 15:90680958-90680980 TGAGACTGGGATGGAAACAGAGG - Intergenic
1133067719 16:3221231-3221253 TGAGGCTGGGTGGGAATGAGAGG - Intergenic
1133289916 16:4713439-4713461 TGAGAGTTGGGGGGAAAAAAAGG + Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1138459490 16:57139758-57139780 AGAGAATCTGTGGGAAAAATGGG + Intronic
1138943727 16:61821974-61821996 TGACACTCAGTGGGCAAAATAGG - Intronic
1139473392 16:67190155-67190177 GGAGCCTCGGTGGGAAGAAGGGG - Exonic
1141062172 16:80883624-80883646 AGAGACTGGGTGGGAGAATGAGG + Intergenic
1141355029 16:83337397-83337419 TGAGAATGGGAGGAAAAAAGGGG - Intronic
1143881402 17:10032840-10032862 TTAGAATCGGTGGGAAAGAAAGG + Intronic
1144961481 17:19046679-19046701 TGAGGCTCCGAGGGAAAAGGTGG + Intronic
1144973679 17:19127845-19127867 TGAGGCTCCGAGGGAAAAGGTGG - Intronic
1145248746 17:21285875-21285897 TGAAACTCGGAGGGCAAAAGGGG + Intronic
1150624079 17:66830258-66830280 TGAGAGGTGGTGGGAAAAGGAGG + Intergenic
1151980465 17:77505425-77505447 AGAGACTCGATGGGAAAGAGGGG - Intergenic
1152220755 17:79064062-79064084 TTAGACTACGTGGGAAAGAGAGG + Intergenic
1152267506 17:79304942-79304964 TGAGACGCGGTGGGAGGGAGGGG - Intronic
1152455223 17:80411636-80411658 TGATCCTCGCTGGAAAAAAGGGG + Intergenic
1153538902 18:6134013-6134035 CGAGACTGGGAAGGAAAAAGAGG + Intronic
1153830653 18:8919476-8919498 TGATCCTCGCTGGAAAAAAGGGG + Intergenic
1154940668 18:21110868-21110890 TGAGACTCGATTTGAAAAAATGG - Exonic
1158292369 18:55956095-55956117 TGATCCTCGCTGGAAAAAAGGGG + Intergenic
1158308170 18:56129245-56129267 TGAGACTCTGTCAAAAAAAGAGG - Intergenic
1158330737 18:56359224-56359246 TGAGACTCGGGGAGAAAAAGAGG - Intergenic
1158683053 18:59586224-59586246 TGATACTCCCTGGGAAGAAGAGG + Intronic
1160290924 18:77592520-77592542 TGAGATTTGGTAGGAAAAATAGG + Intergenic
1161830520 19:6600236-6600258 TGATCCTCGCTGGAAAAAAGAGG + Intronic
1162769566 19:12940889-12940911 TGAGACTTGGAGGAAAAAGGAGG + Intronic
1163823696 19:19511045-19511067 TGGGACTGGGTGGGAAGACGGGG + Intergenic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1165363618 19:35351189-35351211 TGAGACTCTGTGGGGAGGAGGGG - Intergenic
1165365751 19:35363646-35363668 TGAGACTCTGTGGGGAGGAGGGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166855996 19:45782850-45782872 TGGGGCTGGGTGGGAGAAAGGGG + Intronic
1167000892 19:46745580-46745602 TGGGACCCGCTGGGAAAGAGCGG - Intronic
1167516140 19:49924284-49924306 TGAGGCTCGGTGCCAAGAAGGGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168036715 19:53725696-53725718 CGAGACTCTGTCCGAAAAAGAGG - Intergenic
1168039627 19:53747706-53747728 TGAGACTCTGTTTCAAAAAGAGG - Intergenic
1168040784 19:53756998-53757020 TGAGACTCTGTCCCAAAAAGAGG - Intergenic
925689948 2:6511533-6511555 TGAGACCCTGTCTGAAAAAGGGG - Intergenic
928587354 2:32774049-32774071 AAAGACTTGGTGTGAAAAAGTGG + Intronic
928716379 2:34065621-34065643 TGAAACTCGGTGGCAAAACAAGG + Intergenic
932654698 2:73600496-73600518 GGAGAGTAGGAGGGAAAAAGAGG - Intronic
932662856 2:73672128-73672150 GGAGAGTAGGAGGGAAAAAGAGG - Intergenic
932821463 2:74905438-74905460 TGAGACTGGGAAGAAAAAAGAGG + Intergenic
935721211 2:105980955-105980977 TGATCCTCGCTGGAAAAAAGGGG - Intergenic
938768770 2:134482148-134482170 TGAGACTGTATGGGAAAATGGGG - Intronic
938885790 2:135646490-135646512 TGAGTCTTGCAGGGAAAAAGAGG - Intronic
939695425 2:145317389-145317411 TGAGACTCTGGGTGGAAAAGGGG + Intergenic
940552222 2:155174157-155174179 GGGGACTCAGTGGGAAAAGGTGG - Intergenic
941005096 2:160239803-160239825 TCAGACTCCATGGGAAAGAGAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943339359 2:186660328-186660350 TGAGAATAGGTGGGAAAAAAAGG - Intronic
943367631 2:186981070-186981092 TAAGACTAGGTGGGAAAACCAGG - Intergenic
943367758 2:186981868-186981890 TAAGACTAGGTGGGAAAACTAGG - Intergenic
943368115 2:186984236-186984258 TAAGACTAGGTGGGAAAACTAGG - Intergenic
944098598 2:195996975-195996997 TGAGCCCAGGTGGGAAACAGTGG - Intronic
944869771 2:203898335-203898357 TGTGACGCTGGGGGAAAAAGAGG - Intergenic
945624406 2:212184251-212184273 TAAGATTTGGTGGGGAAAAGAGG - Intronic
945753209 2:213813977-213813999 TGAGACACAGAGGGAGAAAGTGG + Intronic
947046967 2:225998702-225998724 GGGGACTCAGGGGGAAAAAGTGG - Intergenic
948915935 2:241035123-241035145 GGAGGCTGGGTGGGAATAAGGGG - Intronic
1170129965 20:13008819-13008841 AGAGAGGGGGTGGGAAAAAGAGG + Intergenic
1171166515 20:22976649-22976671 TGAGCCTCTGGGGGAACAAGAGG + Intergenic
1172392588 20:34575808-34575830 TGAGAGACGGTGTCAAAAAGAGG - Intronic
1172461737 20:35124028-35124050 TGAGGCTCTGTGGGAGAAAGTGG + Exonic
1176236368 20:64055601-64055623 TGAGGCTCAGAGGGAACAAGGGG + Intronic
1176613048 21:9003653-9003675 TGACACTTGTTGGGAAAATGAGG - Intergenic
1177614534 21:23500026-23500048 TGAGACTGGAAAGGAAAAAGAGG + Intergenic
1178447993 21:32662877-32662899 TGATCCTCGCTGGAAAAAAGGGG + Intronic
1179059676 21:37968217-37968239 TGGGACTGGGTGAGAAAAGGAGG + Intronic
1181500746 22:23314325-23314347 TGTGACTCGGAGGGAAGAGGGGG - Intronic
1184540155 22:45117162-45117184 TGAAACTCCGAGGGAGAAAGTGG + Intergenic
949899324 3:8796842-8796864 TGAGACTTGGGGGGAAAGGGTGG + Intronic
950614383 3:14147494-14147516 TGAGACTTGGTGTGAAGGAGAGG - Intronic
951248275 3:20365835-20365857 TGATCCTCGCTGGAAAAAAGAGG - Intergenic
951576687 3:24121719-24121741 TCAGAGTCAGAGGGAAAAAGGGG + Exonic
957406493 3:79779109-79779131 TGATCCTCGCTGGAAAAAAGGGG + Intergenic
957617889 3:82555109-82555131 TTAGATTTGGTAGGAAAAAGAGG - Intergenic
960031154 3:113056184-113056206 TGAGACTCAGTGGGGAGCAGGGG + Intergenic
960073418 3:113457668-113457690 TGAGACTCTGTGTGAAAAAAAGG - Intronic
960437572 3:117645838-117645860 TTAAACTTAGTGGGAAAAAGAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962277329 3:134025766-134025788 TGATCCTCGCTGGAAAAAAGAGG + Intronic
962414165 3:135167313-135167335 TCAGACTCAGTGGGAAAAGATGG + Intronic
964522121 3:157581083-157581105 TGATCCTCGCTGGAAAAAAGGGG - Intronic
964755152 3:160085749-160085771 TAAGACTAGGTGGGAAAACTAGG - Intergenic
967938204 3:194746266-194746288 TGAGACTCAGTGAGAGTAAGTGG + Intergenic
969532217 4:7736432-7736454 TGAGACTCAGTGGGAGAGGGGGG - Intronic
970222405 4:13824499-13824521 TGAGACTGGGAAGAAAAAAGAGG - Intergenic
970876769 4:20879937-20879959 TGAGAGTGGGAGGTAAAAAGAGG + Intronic
971179992 4:24320988-24321010 TGGGACTCGGTGAGAGAAAACGG - Intergenic
971255300 4:25008764-25008786 TTAGGCTTGGTGGTAAAAAGAGG + Intronic
974581913 4:63814520-63814542 TGACAGTCAGTGGGAAGAAGGGG + Intergenic
975205929 4:71644104-71644126 TGATCCTCGCTGGAAAAAAGGGG + Intergenic
976003489 4:80400636-80400658 TGAGACTGGGAAGAAAAAAGGGG - Intronic
977552351 4:98455888-98455910 GGGGACTCGGAGGGAAAAGGTGG + Intergenic
981780873 4:148427606-148427628 TGTGCCTCGGTGGGATAAGGAGG + Intronic
982080237 4:151782773-151782795 TGATGCTCTGTGGAAAAAAGGGG - Intergenic
986010201 5:3707078-3707100 AGAAACCCAGTGGGAAAAAGAGG - Intergenic
988287784 5:29242753-29242775 TGAGACTAGCTGGGCAACAGAGG - Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
988640111 5:33032513-33032535 TGAGAGTAGGAGGGAAACAGAGG - Intergenic
989033187 5:37141043-37141065 AGTGACTAGGTGGGTAAAAGAGG - Intronic
994712117 5:103278694-103278716 TGAAACTCTGTGGCAAAAATAGG + Intergenic
996088278 5:119326025-119326047 TGACATTCAGTGGGAAAAAGCGG - Intronic
996194666 5:120589535-120589557 TGAGACTGGGAGGATAAAAGAGG + Intronic
996406180 5:123106414-123106436 TGAGGCTTGGTGGTAAAAAATGG + Intronic
997105488 5:131014308-131014330 GGGGACTCAGTGGGAAAGAGGGG - Intergenic
997238003 5:132285514-132285536 TGAGACTCTGTTGCAAAACGAGG - Intronic
998320749 5:141227769-141227791 TATGACTCTGAGGGAAAAAGGGG - Intergenic
999043099 5:148437380-148437402 TGTGACTTGGTGGAAAGAAGGGG - Intronic
1000127746 5:158263407-158263429 TGAGGATTGGTGGGAAAGAGAGG - Intergenic
1001382310 5:171312572-171312594 TGAGGCTCCGCGGGAAAAAGAGG - Intergenic
1001435851 5:171698746-171698768 TGAGATTCTGTGGGAAGGAGAGG + Intergenic
1001493165 5:172169590-172169612 TGAGACTAGGTGGGTATGAGAGG + Intronic
1001885422 5:175286166-175286188 TCTGACTTGGTGGGGAAAAGGGG - Intergenic
1002998841 6:2312270-2312292 TGATCCTCGCTGGAAAAAAGGGG - Intergenic
1004257976 6:14082511-14082533 CGAGGCTGGGTGGGAAAGAGAGG + Intergenic
1007093217 6:39197244-39197266 TGAGGTTTGGTGGGAAAAAAAGG + Intronic
1008351775 6:50499758-50499780 TGAGACACACTGGGAAACAGAGG - Intergenic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1008731195 6:54484683-54484705 GTAGACTGGGTGGGAAAGAGAGG - Intergenic
1009667507 6:66703340-66703362 TGAGAGTCTGTGGGCAAAAATGG - Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1014497195 6:122139901-122139923 TGAGACTTTGTGGGAACAAAAGG + Intergenic
1015150277 6:130029829-130029851 TGAGACTCTGTCTCAAAAAGAGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016212915 6:141562251-141562273 TGAGAAACAGTGGGGAAAAGGGG - Intergenic
1017076897 6:150626980-150627002 TGGGACATGCTGGGAAAAAGGGG + Intronic
1017681682 6:156870646-156870668 TTAGACCTGGTGGGAAAATGTGG + Intronic
1018195861 6:161355899-161355921 TGGGACTCGTTGGGTAAAGGGGG + Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1022568102 7:31423611-31423633 GGAGACTCAGGGGGAAATAGTGG - Intergenic
1023309317 7:38867595-38867617 TAAGAATGGGTGTGAAAAAGAGG + Intronic
1023777497 7:43621849-43621871 TGAGTCACGGAAGGAAAAAGAGG - Intronic
1026120254 7:67530429-67530451 TGAGATTTGGAAGGAAAAAGAGG + Intergenic
1026574304 7:71559503-71559525 TGAGCCTCAGTTGGAAAATGGGG + Intronic
1026872188 7:73859709-73859731 TGAGACTCTGTGATAAAAAGAGG - Intergenic
1027211909 7:76156179-76156201 TGAGACTCTGTATCAAAAAGGGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031038470 7:116813992-116814014 TCAGTCTCGGGGGGAAAAATGGG - Intronic
1040384484 8:46905052-46905074 GGAGACTTGGTGGGAACATGTGG - Intergenic
1041515738 8:58696983-58697005 TGACCCTCGCTGGAAAAAAGAGG + Intergenic
1042303045 8:67306787-67306809 TGAGACTCTGTCTGAAAAAAAGG - Intronic
1045240437 8:100396015-100396037 TCAGCCTGGGTGGGAAAGAGAGG - Intronic
1048326570 8:133443688-133443710 TGGGAGTTGGTGGGAGAAAGTGG + Intergenic
1048654281 8:136518171-136518193 ACAGACTCCGTGGGAGAAAGGGG - Intergenic
1048746073 8:137616057-137616079 AGAGACCCGGGAGGAAAAAGTGG - Intergenic
1049204086 8:141355317-141355339 TGAGGCTCAGAGGGAGAAAGGGG - Intergenic
1051839813 9:21382621-21382643 TGAGGCTCAGTGAGAATAAGTGG + Intergenic
1052443663 9:28531356-28531378 TGAAACTTGGGGAGAAAAAGAGG - Intronic
1052588720 9:30463076-30463098 TGGGACTAGGAGGGAAAAATGGG + Intergenic
1053649123 9:40145871-40145893 TGACACTTGTTGGGAAAATGAGG + Intergenic
1053756620 9:41318013-41318035 TGACACTTGTTGGGAAAATGAGG - Intergenic
1054535458 9:66230302-66230324 TGACACTTGTTGGGAAAATGAGG - Intergenic
1055620920 9:78124367-78124389 TGACAATAGGTGGGAAGAAGAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059773070 9:117445944-117445966 TGAGATTGGGTGGGAATAAAAGG + Intergenic
1187779687 X:22805494-22805516 TGAGACTTTGTGGAAAAAAAAGG + Intergenic
1189482785 X:41405985-41406007 AGAGGCTCGGTGGTCAAAAGCGG - Intergenic
1190425555 X:50331849-50331871 TGATTCTCGCTGGAAAAAAGGGG - Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192831821 X:74758166-74758188 GGAGAGTGGGTGGGAAGAAGGGG + Intronic
1193483231 X:82053517-82053539 TGGCACTGAGTGGGAAAAAGTGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195750839 X:108161133-108161155 AGAGGCTCGGTGGGAAACTGTGG - Intronic
1196022111 X:111001254-111001276 TGTGACTTGGTTGGAAACAGAGG - Intronic
1196471601 X:116035213-116035235 TGAGACTCAGGGGGAAATGGTGG + Intergenic
1201385669 Y:13437171-13437193 TAAGACTAGGAGGGAAAAACAGG + Intronic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic