ID: 1163836644

View in Genome Browser
Species Human (GRCh38)
Location 19:19579057-19579079
Sequence CACGCCCGGCCCAGACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163836644_1163836657 21 Left 1163836644 19:19579057-19579079 CCACCCAGTCTGGGCCGGGCGTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1163836657 19:19579101-19579123 AGCACTTTGGGAGGCCAAGGAGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
1163836644_1163836658 22 Left 1163836644 19:19579057-19579079 CCACCCAGTCTGGGCCGGGCGTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1163836658 19:19579102-19579124 GCACTTTGGGAGGCCAAGGAGGG 0: 3198
1: 93624
2: 217316
3: 239801
4: 152513
1163836644_1163836650 8 Left 1163836644 19:19579057-19579079 CCACCCAGTCTGGGCCGGGCGTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1163836650 19:19579088-19579110 TACCTGTAATCCCAGCACTTTGG 0: 4761
1: 166787
2: 306278
3: 212252
4: 197042
1163836644_1163836655 18 Left 1163836644 19:19579057-19579079 CCACCCAGTCTGGGCCGGGCGTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1163836655 19:19579098-19579120 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1163836644_1163836651 9 Left 1163836644 19:19579057-19579079 CCACCCAGTCTGGGCCGGGCGTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1163836651 19:19579089-19579111 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1163836644_1163836659 25 Left 1163836644 19:19579057-19579079 CCACCCAGTCTGGGCCGGGCGTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1163836659 19:19579105-19579127 CTTTGGGAGGCCAAGGAGGGTGG 0: 1980
1: 44531
2: 140101
3: 174142
4: 141066
1163836644_1163836653 12 Left 1163836644 19:19579057-19579079 CCACCCAGTCTGGGCCGGGCGTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1163836653 19:19579092-19579114 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163836644 Original CRISPR CACGCCCGGCCCAGACTGGG TGG (reversed) Intronic
900380628 1:2382166-2382188 CTCGCCCGGCCCAGGCCGGAGGG + Intronic
900731542 1:4264954-4264976 CAAGACTGGCACAGACTGGGGGG + Intergenic
901373266 1:8818054-8818076 CCAGCCCGGCCCAGCCCGGGGGG - Intergenic
903153735 1:21430384-21430406 CAGGCCTGGCTCAGACTGGAAGG + Intergenic
904135980 1:28312889-28312911 CGCGCCCGGCCTGGAATGGGTGG + Intergenic
905041530 1:34964005-34964027 CACGCCTGGCCAAGAGTGGCTGG - Intergenic
905280487 1:36846081-36846103 CACACCCGGCCCACTCTTGGGGG - Intronic
906403653 1:45523977-45523999 CGCGCCCGGCCCTGACAGTGAGG - Intergenic
917211421 1:172635575-172635597 CACGCCAAGTCCATACTGGGTGG - Intergenic
920033103 1:203048995-203049017 CCAGCCCCGCCCAGCCTGGGAGG + Intronic
922237536 1:223733363-223733385 CAGGCCCAGCCCATCCTGGGGGG - Intronic
1067480865 10:46596801-46596823 CAAGCCTGGGCCAGACTTGGGGG + Intergenic
1070760509 10:79021464-79021486 CACTCCCCGCCCAGATTTGGAGG + Intergenic
1070807441 10:79279027-79279049 CACCCACGTCCCAGACGGGGCGG + Intronic
1073057961 10:100714113-100714135 CCCGCCAGGTCCAGATTGGGGGG + Intergenic
1074523699 10:114246987-114247009 CATGCCTGGCCCAGGCTGAGGGG - Intronic
1076704431 10:132293553-132293575 CTCCCCTGGCCCAGTCTGGGTGG - Intronic
1076825367 10:132964597-132964619 CAGGCCTGGCCCAGGCTGGGTGG - Intergenic
1077053167 11:576750-576772 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053174 11:576769-576791 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053181 11:576788-576810 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053188 11:576807-576829 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053195 11:576826-576848 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053202 11:576845-576867 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053209 11:576864-576886 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053216 11:576883-576905 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1077053223 11:576902-576924 GAGGCCCCGCCGAGACTGGGAGG + Intronic
1078400230 11:11019873-11019895 CAGGCCTGGCCCAGACTTAGAGG - Intergenic
1079095083 11:17504777-17504799 CACGGCAGCCCCAGACTGGCAGG - Intronic
1081995412 11:47360534-47360556 CGCGCGCGGCCCTGGCTGGGAGG - Intronic
1085518926 11:77127011-77127033 CTGGCCCCGCCCAGCCTGGGAGG + Intergenic
1090379127 11:126312965-126312987 CAGGCCCTGCCCAGCCTGGAGGG - Intronic
1092331266 12:7589817-7589839 CACCTCCCTCCCAGACTGGGCGG + Intergenic
1095307078 12:40651279-40651301 CAAGCCAGGCACAGCCTGGGTGG - Intergenic
1098019175 12:66135286-66135308 CACCTCCCTCCCAGACTGGGCGG - Intronic
1103521128 12:121537539-121537561 CACGGCCGGGCCAGCCGGGGAGG + Intronic
1103593005 12:122005575-122005597 CACACCCAGCCCAGCCTGGCAGG + Intergenic
1104903128 12:132199717-132199739 CAAGCCCGGGCCAGACTGCTGGG + Intronic
1104966117 12:132509485-132509507 CACGCCCGGCCCAGCCCTGCCGG + Intronic
1107305194 13:39011371-39011393 CAAGCCTGTCCCAGAGTGGGTGG - Exonic
1107655200 13:42585732-42585754 GACCCCCTGGCCAGACTGGGTGG + Intronic
1108050421 13:46430280-46430302 CAAGCCCAGCCCAGGCTGTGAGG + Intronic
1108350267 13:49585353-49585375 CACTCCCGGCCCGGCCTGCGGGG + Intronic
1108518225 13:51222414-51222436 CCCGGCCGGCTCGGACTGGGCGG + Exonic
1109542997 13:63803904-63803926 CAAGCCCGGCCCAGGCTGTGAGG + Intergenic
1112272023 13:97976882-97976904 CCCGCCGGGCCCAGCCTGCGCGG - Intronic
1118428584 14:65692615-65692637 CACCCCCCTCCCAGACGGGGTGG + Intronic
1122775869 14:104116812-104116834 CACCCCCGGCCCAGACGAGACGG + Intergenic
1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG + Intronic
1127295112 15:57602175-57602197 CACCCCCGTCCCAGTCTGGTTGG - Intronic
1127388017 15:58482911-58482933 CAAGCCTTGCACAGACTGGGTGG + Intronic
1129331232 15:74828411-74828433 CAGGCCTGGCCCAGGCTTGGTGG - Intronic
1130399499 15:83536293-83536315 CACACTCAGCCAAGACTGGGTGG + Intronic
1130411582 15:83653289-83653311 CAAGCCCGGCTCAGACAAGGAGG + Intergenic
1131189409 15:90301640-90301662 CACCCCCTGCCAAGAATGGGGGG - Intronic
1132374830 15:101322185-101322207 CATCCCCGGCCCAGACAGCGAGG + Intronic
1132553178 16:561491-561513 CAGACCCGGCCTGGACTGGGTGG - Intronic
1132578394 16:674362-674384 CGCGCCCGGCATGGACTGGGGGG + Intronic
1132699772 16:1217428-1217450 CAGCCTCGGCCCAGGCTGGGCGG + Intronic
1133911411 16:10069715-10069737 TATGCCCAGCCCAGGCTGGGAGG + Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1136114719 16:28087444-28087466 CCCACTCAGCCCAGACTGGGAGG + Intergenic
1136424333 16:30159151-30159173 CACACCCAGCACAGACGGGGTGG - Intergenic
1137984229 16:53094257-53094279 CCCGCCCAGCCCAGACTAGGCGG - Intronic
1139465797 16:67153385-67153407 CGCACCTGGCCAAGACTGGGAGG - Intergenic
1139509146 16:67416440-67416462 CAGGCCAGACCCAGACTGGCTGG + Exonic
1139930867 16:70524967-70524989 CGCGCCCGGCCCAGACGTGGGGG + Intronic
1141137527 16:81476157-81476179 CACGCACTGCCAAGACTGAGTGG - Intronic
1141767784 16:86070190-86070212 CACGCCGGGCCCAGTCTGGCCGG + Intergenic
1142470947 17:162973-162995 CACACCCGGCCCAGGCTGGGAGG + Intronic
1142949253 17:3464867-3464889 CACCCCCCTCCCAGACGGGGTGG - Intronic
1143115047 17:4577350-4577372 CAGGCCAGGCCCAGCCTGGGTGG - Intergenic
1143562873 17:7705606-7705628 GCCCCCCGGCCCAGAATGGGGGG - Exonic
1144826048 17:18106290-18106312 CACACAAGGCCCAGACTGTGTGG + Intronic
1145061556 17:19737407-19737429 CCTGCCAGGCCCAGGCTGGGAGG + Intergenic
1147705499 17:42422506-42422528 GGCGCCCGGGCCAGGCTGGGAGG + Intronic
1148090925 17:45022111-45022133 GAGGCCCGGCCCAGCCCGGGAGG + Intergenic
1149975454 17:61261295-61261317 CTCGCCCAGCTAAGACTGGGAGG - Intronic
1150527414 17:65937721-65937743 CACCCCCCTCCCAGACTGGGCGG - Intronic
1150527436 17:65937771-65937793 CACCCCCCTCCCAGACGGGGCGG - Intronic
1160748601 19:723067-723089 CACCCCCAGCCCCGCCTGGGAGG - Intronic
1160865745 19:1255216-1255238 CACGCCTGGCCCTGCCCGGGGGG + Intronic
1163374750 19:16923160-16923182 CACTCCCAGCCCAGCCTTGGAGG - Intronic
1163610939 19:18301251-18301273 GAGGCCAGGCCCAGGCTGGGAGG + Intergenic
1163836644 19:19579057-19579079 CACGCCCGGCCCAGACTGGGTGG - Intronic
1165151621 19:33763969-33763991 CACCCCCAGCCCTGGCTGGGTGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166669886 19:44703541-44703563 CTGGCCCGGCCCACACGGGGCGG + Exonic
1166996509 19:46722103-46722125 CAGGCGAGGCCCAGAGTGGGAGG - Intronic
1168275931 19:55278620-55278642 CACGCCCAGCCTAGACTGCTTGG - Intronic
1168697484 19:58412498-58412520 CACGCCCGGCCTGGCCAGGGTGG + Intronic
932764792 2:74462728-74462750 CAAGCCCTGCCAAGACTGGCAGG - Exonic
936070645 2:109369051-109369073 CATGCCCGGCCAAGTGTGGGAGG - Intronic
936077736 2:109412354-109412376 CACGCTGGGGCCACACTGGGAGG - Intronic
938063086 2:128267291-128267313 CAGGCCTGGCTCAGACTGGAAGG - Exonic
938533981 2:132221572-132221594 CACCTCCCTCCCAGACTGGGCGG - Intronic
942081369 2:172402387-172402409 CTCTCCCAGCCCAGACTGGATGG - Intergenic
1174164094 20:48572394-48572416 TACCCCCGGCCCAGAGCGGGTGG + Intergenic
1175368626 20:58471857-58471879 CACTCCAGCCCCAGGCTGGGTGG - Intronic
1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG + Intronic
1176027745 20:62994540-62994562 CAGGCCAGGCCCAGACAGCGGGG - Intergenic
1179496967 21:41778205-41778227 CACGCCCGGCCCAGGGTTGGGGG + Intergenic
1179501259 21:41810439-41810461 CACGCCCCGCCCATCCTGAGAGG + Intronic
1179654704 21:42837861-42837883 CACGCACAGCCCAGTCTGCGGGG - Intergenic
1181260264 22:21592276-21592298 CACCCCAGTCCCAGACTGGATGG + Intronic
1182208746 22:28655575-28655597 CACGCCCGGCCTAGGGTGAGGGG - Intronic
1182892645 22:33831853-33831875 TACGCCTGGGCCAGGCTGGGAGG - Intronic
1184222821 22:43111418-43111440 CAGGTGCGCCCCAGACTGGGCGG + Intronic
1184449126 22:44572601-44572623 CACACCCAGCTCAGCCTGGGAGG - Intergenic
1184524706 22:45014990-45015012 TGTGCCCGGCCCAGGCTGGGAGG + Intergenic
1185316404 22:50181052-50181074 CACGCCAGGCCCTGGCTGTGGGG - Intergenic
1185398418 22:50604049-50604071 CTCGCCCGGCTCCGACTCGGAGG + Exonic
949308863 3:2673461-2673483 CAAGCCCAGCCCAGACTAAGGGG - Intronic
949937857 3:9130935-9130957 CATGCACAGCCCAGCCTGGGAGG - Intronic
958957317 3:100477744-100477766 CACCTCCCTCCCAGACTGGGCGG + Intergenic
958957414 3:100477968-100477990 CACCTCCCTCCCAGACTGGGCGG + Intergenic
962828559 3:139120376-139120398 CAGGCCTGGCCTAGACTGAGAGG - Intronic
964351296 3:155806107-155806129 CACCACCCGCCCAGACTGCGTGG + Intronic
965599904 3:170444350-170444372 CATGCCCGGCCCTGGCTGAGAGG + Intronic
967876512 3:194271473-194271495 CCCTCCAGGCCCAGGCTGGGTGG + Intergenic
968488566 4:877106-877128 CACGCCCGGTCCACTCTGGGCGG - Exonic
968634934 4:1673186-1673208 GAGGCCCTGCCCAGACTGGAGGG + Intronic
968938560 4:3626155-3626177 CACACCAGGCCCCGGCTGGGTGG - Intergenic
969116217 4:4872233-4872255 CACGCCCGGCCCCGACTTATCGG + Intergenic
969998885 4:11343861-11343883 CAGGCCTGGTCCAGCCTGGGCGG + Intergenic
970591095 4:17561291-17561313 CAAGCCGGGCCCAGGCTGTGTGG - Intergenic
970591871 4:17566764-17566786 CAAGCCTGGCCCAGGCTGTGTGG - Intergenic
972277348 4:37569488-37569510 CACGCCCGGCCCCGAGGAGGTGG + Intronic
978620566 4:110631940-110631962 CACGCCCCACCCAGACTTGTGGG - Intronic
983604619 4:169570434-169570456 CACCTCCCTCCCAGACTGGGCGG - Intronic
984090484 4:175368398-175368420 CAGGACCAGTCCAGACTGGGTGG + Intergenic
984803940 4:183736294-183736316 CACCTCCCTCCCAGACTGGGCGG + Intergenic
986332910 5:6730634-6730656 CCCTCCCTGCCCAGAGTGGGCGG + Intronic
986462201 5:7983646-7983668 TACGCAGGGCCCAGCCTGGGTGG + Intergenic
989710125 5:44388297-44388319 CACCCCCAGCCCACACGGGGGGG - Intronic
994343608 5:98660957-98660979 CACGCCCGGCCCACAGTGCCTGG + Intergenic
1003307749 6:4944968-4944990 AACGTCAGGCCCAGACTGGGGGG + Intronic
1003407280 6:5835522-5835544 CACCTCCCTCCCAGACTGGGCGG + Intergenic
1010926831 6:81753914-81753936 CCCTGCCCGCCCAGACTGGGAGG + Intergenic
1017030838 6:150220144-150220166 CGCGCCCGGCCAAGACTGTTTGG + Intronic
1018046295 6:159969224-159969246 CGCGCCGGGCCCGGACTGCGCGG - Exonic
1019298640 7:291635-291657 CACACCAGGCCTGGACTGGGGGG + Intergenic
1020212700 7:6167832-6167854 CACACCTGGCCCCGCCTGGGAGG + Intronic
1022519301 7:30995519-30995541 CAGCCCTGGCCCAGACTGAGAGG + Intergenic
1025808498 7:64856874-64856896 CACCTCCCTCCCAGACTGGGCGG - Intergenic
1027795720 7:82691174-82691196 CAAGCCAGGCACAGCCTGGGTGG - Intergenic
1028993902 7:97078486-97078508 CACGCCTGGCACAGAGTTGGTGG + Intergenic
1029270476 7:99374431-99374453 TGCGCCCGGCCCAGGCTCGGAGG + Intronic
1031398889 7:121307549-121307571 CACTCCCTGGCCAGACTAGGTGG + Intergenic
1034902131 7:154914320-154914342 CAGGCCCGGCCCCGGCTGGAGGG - Intergenic
1035486005 7:159226625-159226647 CAGGCCTGGCCCAGAGTGAGGGG + Intergenic
1036661769 8:10713895-10713917 CACACCAGGCCCAGCCTGGCAGG + Intergenic
1038251803 8:25911891-25911913 GACGCCGTGCCCAGAGTGGGCGG + Intronic
1038965063 8:32562594-32562616 CATGCCTGGGCCAGACTGAGAGG + Intronic
1039996843 8:42541627-42541649 CGCGCCCGGCCCCGACTCCGGGG + Intronic
1043028564 8:75102875-75102897 CACGCCCAGCCCAGACTGCCTGG + Intergenic
1048942804 8:139416813-139416835 CACGCCCGGCCTAAACTCTGAGG - Intergenic
1049372327 8:142273766-142273788 CACGCAGGGGCCTGACTGGGTGG - Intronic
1051575060 9:18605871-18605893 CACGCTTGACCCAGGCTGGGTGG + Intronic
1054452181 9:65409181-65409203 CACACCAGGCCCCGGCTGGGTGG + Intergenic
1057898101 9:98925591-98925613 CAGGCCTGGCCGAGAGTGGGTGG + Intergenic
1060553161 9:124495195-124495217 CAGGCTCAGCCCTGACTGGGAGG + Intronic
1062014712 9:134285230-134285252 CACGCCCACCCCAGGCTGGAGGG - Intergenic
1062600243 9:137316090-137316112 CGCGCCCCGCCGAGGCTGGGGGG - Intronic
1185447697 X:268167-268189 CAGGCCCCACCCACACTGGGTGG - Intergenic
1185833286 X:3321515-3321537 CAAGGACGGCCCAGCCTGGGAGG - Exonic
1185929922 X:4191156-4191178 CACGCCCAGCCAAGAATGGCAGG - Intergenic
1187429248 X:19206613-19206635 CAGGCCAGGCCCAGCCTGGATGG - Intergenic
1190008170 X:46759291-46759313 AACACCCGGCCCCGCCTGGGTGG - Intergenic
1190715097 X:53096532-53096554 CACACCCGGCCCTGTTTGGGGGG - Intergenic