ID: 1163838009

View in Genome Browser
Species Human (GRCh38)
Location 19:19587880-19587902
Sequence GATTCTTCACAGAGCACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163838009_1163838023 22 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838023 19:19587925-19587947 CTGGGTGAAGGGAGAGGAGGGGG 0: 2
1: 1
2: 17
3: 223
4: 1740
1163838009_1163838016 10 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838016 19:19587913-19587935 CCTACTACATGCCTGGGTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 161
1163838009_1163838013 4 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838013 19:19587907-19587929 TACATCCCTACTACATGCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 134
1163838009_1163838024 25 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838024 19:19587928-19587950 GGTGAAGGGAGAGGAGGGGGTGG 0: 2
1: 2
2: 96
3: 1253
4: 9173
1163838009_1163838017 11 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838017 19:19587914-19587936 CTACTACATGCCTGGGTGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 122
1163838009_1163838020 20 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838020 19:19587923-19587945 GCCTGGGTGAAGGGAGAGGAGGG 0: 1
1: 6
2: 10
3: 101
4: 992
1163838009_1163838012 3 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838012 19:19587906-19587928 TTACATCCCTACTACATGCCTGG 0: 1
1: 1
2: 5
3: 74
4: 412
1163838009_1163838022 21 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838022 19:19587924-19587946 CCTGGGTGAAGGGAGAGGAGGGG 0: 1
1: 3
2: 12
3: 114
4: 1039
1163838009_1163838019 19 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838019 19:19587922-19587944 TGCCTGGGTGAAGGGAGAGGAGG 0: 1
1: 5
2: 11
3: 93
4: 799
1163838009_1163838018 16 Left 1163838009 19:19587880-19587902 CCCAGAGTGCTCTGTGAAGAATC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1163838018 19:19587919-19587941 ACATGCCTGGGTGAAGGGAGAGG 0: 1
1: 1
2: 7
3: 36
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163838009 Original CRISPR GATTCTTCACAGAGCACTCT GGG (reversed) Intronic
900290660 1:1922264-1922286 GCCTCTGCACAGAGCACCCTCGG - Exonic
901180263 1:7336799-7336821 CCTCCTTCACAGAGCTCTCTCGG + Intronic
901614936 1:10531142-10531164 GATTCCAGGCAGAGCACTCTCGG - Intronic
905887760 1:41500836-41500858 GATTCTTCACAGAAGCCACTGGG - Intergenic
908773767 1:67619850-67619872 CATTCTTGGCAGAGCACTCCTGG + Intergenic
908909244 1:69053715-69053737 AATTTTTCACAAAGCTCTCTAGG + Intergenic
910017852 1:82549629-82549651 AATTCTTATCAGAGTACTCTAGG - Intergenic
913548049 1:119889150-119889172 GAGTTTTGACAGAGCATTCTTGG - Intergenic
918043906 1:180929647-180929669 GATTCTTCAAAGTGCACCATCGG - Intronic
919622156 1:199875027-199875049 GATTCTTAACAGAGAAATTTGGG + Intergenic
919859517 1:201730104-201730126 GATTCATCACACTGGACTCTGGG + Intronic
920185047 1:204154271-204154293 GATTCTTGACCGAGTAATCTTGG + Intergenic
921485407 1:215709743-215709765 CATTCTTCAAAGAGCCATCTGGG - Intronic
924270914 1:242331820-242331842 TATTATGCACAGGGCACTCTAGG - Intronic
1065348794 10:24776148-24776170 CCTTCTTCACATAGCACTGTAGG + Intergenic
1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG + Intergenic
1072896274 10:99369920-99369942 GAACCTTCACAGCACACTCTTGG - Intronic
1074323661 10:112427135-112427157 CTTTCTTCACAGAGCACTCAGGG + Intronic
1075393077 10:122107211-122107233 GATGCTTTTCAGAGCACACTTGG - Intronic
1080568231 11:33531971-33531993 CAGTCTTCTCAGACCACTCTGGG + Intergenic
1080899711 11:36477924-36477946 GATTCTTGCAAGAGCACTCGAGG - Intergenic
1081962627 11:47149440-47149462 GATTCTTTCCCGAGCCCTCTGGG + Intronic
1082960739 11:58916559-58916581 GAGGCTTCACAGTGCAATCTGGG + Intronic
1083999369 11:66287988-66288010 GATTCCTCACAGTGCCCTCAGGG - Intronic
1088117227 11:106326541-106326563 GATACTGCACAGGGCACCCTGGG + Intergenic
1091606504 12:1957216-1957238 GATTCTTCACAGAGAACCTGAGG + Intronic
1092980582 12:13790626-13790648 GATTCTCCACAGAGGATTCATGG - Intronic
1095046414 12:37512515-37512537 GCTTGTTCACTCAGCACTCTTGG - Intergenic
1095988753 12:48018939-48018961 GATTCTTAACAGCACACTCATGG - Intergenic
1100122451 12:91384344-91384366 TATTCTTCACAAAACTCTCTGGG + Intergenic
1104535427 12:129613915-129613937 GATTCTGCAGACAGTACTCTGGG - Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1110278858 13:73669374-73669396 GATTCTCCACAGATCTTTCTTGG + Intergenic
1116065353 14:39974881-39974903 AACTGTTAACAGAGCACTCTTGG - Intergenic
1117362087 14:54985639-54985661 CATTCTCCACAGAGCAGCCTAGG - Intronic
1118256068 14:64207085-64207107 CATTCTTCACAGTGCACACAGGG + Intronic
1119828883 14:77683109-77683131 GATGCCTCACTTAGCACTCTGGG - Intronic
1122396450 14:101436067-101436089 CATGCTTCACAGAGCATCCTGGG + Intergenic
1123143468 14:106105747-106105769 GGTTCTTCACAGAGGACCCTGGG - Intergenic
1123277821 15:17932760-17932782 GAAGTTTCACAGAGTACTCTGGG - Intergenic
1124240776 15:28026133-28026155 GATTCTTCACTGATCACGCATGG + Intronic
1126318355 15:47395231-47395253 TTTTCTTCAAAGAGTACTCTTGG + Intronic
1129525410 15:76210653-76210675 CACCCTTCACCGAGCACTCTAGG + Intronic
1130359063 15:83164042-83164064 GAGGCTTCACAGCGCCCTCTGGG + Exonic
1130619115 15:85442900-85442922 AATGCTTCACAGAGCTTTCTGGG - Intronic
1141311471 16:82917422-82917444 GATTCTTCACAGGGAAGTCCTGG + Intronic
1141921295 16:87137351-87137373 GATTCAATACAGAGCAGTCTTGG - Intronic
1144659156 17:17057214-17057236 GGCTCTTCACAGAGGAGTCTGGG + Intronic
1144794711 17:17883128-17883150 GAGGGCTCACAGAGCACTCTCGG - Intronic
1149854524 17:60068838-60068860 GAATATTCACAGAGTACTCTGGG - Intronic
1151543909 17:74780328-74780350 GATGCTGCACTGAGCTCTCTAGG + Intronic
1156234251 18:35185706-35185728 CATTCTCCACAGAACACTATTGG + Intergenic
1157430407 18:47619880-47619902 GACTCTTCACTCAGCACTCAGGG - Intergenic
1163838009 19:19587880-19587902 GATTCTTCACAGAGCACTCTGGG - Intronic
925091519 2:1160442-1160464 GATTCTACACACAGCAGCCTCGG - Intronic
925152200 2:1622687-1622709 GATTCATCACAGTGAAGTCTGGG + Intergenic
927320995 2:21745567-21745589 GATTCTTCCCAGTGGGCTCTTGG + Intergenic
930246956 2:48993562-48993584 CATTCTCCATACAGCACTCTGGG + Intronic
931387396 2:61809848-61809870 GATTCTTCACATGGCAGTCTTGG - Intergenic
932344394 2:70986084-70986106 CATACTACACAGATCACTCTGGG - Exonic
933099244 2:78230736-78230758 GAATCTTTACAGAGCATCCTAGG - Intergenic
933878987 2:86649028-86649050 TTTTCTTCACACAGCAATCTGGG - Intronic
933973367 2:87488321-87488343 GACTCTGAACAAAGCACTCTGGG + Intergenic
934050807 2:88209104-88209126 GATTCTTCAAACTGGACTCTGGG + Intergenic
936320354 2:111461889-111461911 GACTCTGAACAAAGCACTCTGGG - Intergenic
937952394 2:127398508-127398530 GAAACTTCACAGATCTCTCTTGG - Intergenic
939028500 2:137042891-137042913 GAATTCTCACAAAGCACTCTGGG + Intronic
939378522 2:141402734-141402756 GATTGTTCACAGATCTTTCTGGG + Intronic
939561743 2:143740467-143740489 AAATTTTCACAGAGAACTCTAGG + Intronic
942967670 2:181916334-181916356 GAGGATTCACAGAGCACACTCGG - Exonic
944332774 2:198491314-198491336 AATTCTTCCCAGAGCATTCCAGG - Intronic
946341097 2:219069435-219069457 GAGTCATCACAGAGCACCCTAGG - Intergenic
948414462 2:237792353-237792375 GTTTCTTCACAGAGCCTTCTGGG + Intronic
949032198 2:241802505-241802527 CATTCTCCACAGAGCGCTCAGGG - Intronic
1170127855 20:12985780-12985802 GATTATTCACAGTGCACCATAGG + Intergenic
1171279726 20:23885799-23885821 TATGCTTCCCAGAGCACACTTGG + Intergenic
1171947057 20:31387996-31388018 CATGCTTTACCGAGCACTCTTGG + Intronic
1172536900 20:35680929-35680951 GATAATTCACAGTGCACTGTGGG - Intronic
1172765932 20:37350778-37350800 GCTTCTCAACACAGCACTCTAGG - Intronic
1172934925 20:38613319-38613341 GAATTCTCACATAGCACTCTGGG - Intronic
1173256820 20:41399669-41399691 GATTGGTCTCAGAGCACTGTGGG - Intergenic
1173427767 20:42957875-42957897 CATTCTGCACAGGGCACTCCTGG - Intronic
1173517332 20:43674043-43674065 GCCTCTTCTCAGAGCATTCTGGG + Intronic
1174729839 20:52905166-52905188 GATTTTTCAAAGTGCATTCTGGG - Intergenic
1176307639 21:5132474-5132496 GACTTTTCACAGAGCTCTGTAGG - Intronic
1177011141 21:15730712-15730734 GATGCCACACAGAGCACTGTAGG - Intronic
1177017333 21:15808471-15808493 GATTCATTACAGAGCTCTTTGGG + Intronic
1179050513 21:37885129-37885151 GTTTCTTCACCAAGCACTCAGGG - Intronic
1179281565 21:39938498-39938520 GAGTCTTCACAGCTCCCTCTCGG - Intergenic
1179849421 21:44129556-44129578 GACTTTTCACAGAGCTCTGTAGG + Intronic
1180636037 22:17263856-17263878 GCTTCTCCACAGAGCACACCAGG + Intergenic
1180891201 22:19290865-19290887 GATTTAACACAGAGCACTCAGGG + Intronic
1183457768 22:37932049-37932071 GATGCTCAAGAGAGCACTCTTGG + Intronic
1183583765 22:38740392-38740414 GCTCCTTCACAGAGCTCTCCTGG + Exonic
949865100 3:8540966-8540988 CCTTCTTCACATAGCACTCTCGG + Intronic
950852501 3:16076001-16076023 GATTCTTGTCAGAACACACTGGG + Intergenic
951028173 3:17851356-17851378 GAGTCTTCAGAGGGCAATCTAGG - Intronic
952918490 3:38267553-38267575 GATTGCTCACAGACTACTCTAGG + Intronic
953348230 3:42194166-42194188 AATACAACACAGAGCACTCTGGG + Intronic
955510607 3:59676821-59676843 CTTTCTTCCCACAGCACTCTGGG + Intergenic
956090968 3:65666797-65666819 GATTCATCACAGATCAATCACGG + Intronic
958061127 3:88482540-88482562 GATTCTTCACAGCTTAATCTAGG - Intergenic
963700473 3:148619249-148619271 GATTCTTAGCAGAGAACTGTAGG + Intergenic
965285403 3:166812816-166812838 GATTCAAGACAGAGCACTTTAGG - Intergenic
965679327 3:171234249-171234271 GAATGTTCACAGAGCATACTTGG + Intronic
972649722 4:41004969-41004991 GATTTTTCACTGAGCAGTATTGG - Intronic
975049655 4:69844655-69844677 GATTTTTCACAGGGGACTTTAGG - Intronic
977107455 4:92906509-92906531 GAAACTTCATAGAGCTCTCTTGG + Intronic
977858299 4:101923086-101923108 AATTCCTCATAGAGCACTTTAGG + Intronic
982236927 4:153260324-153260346 CATTCATCTCACAGCACTCTGGG - Intronic
982508621 4:156251877-156251899 GATTCTTGACATACCACACTGGG + Intergenic
989102073 5:37832905-37832927 GATTCTTCCCAAAGGACTTTAGG + Intronic
990190666 5:53256560-53256582 GAATCTACACAGAACTCTCTGGG + Intergenic
990249035 5:53893834-53893856 GATTCTTCAGAGTGCATTCTTGG + Intronic
990982733 5:61616237-61616259 GCCACTTCACAGAGCCCTCTGGG - Intergenic
991188208 5:63836017-63836039 GATTCTTAGTAGAGCAATCTGGG - Intergenic
991329441 5:65477780-65477802 GTTTCTTCACTGAGCACTGGAGG - Intronic
994931355 5:106189815-106189837 GGTTCTTCACTGAGAGCTCTAGG + Intergenic
995318822 5:110807550-110807572 GAGTCTACACAGAGCCCTCCAGG + Intergenic
996368872 5:122732313-122732335 TATTCTCCATAGAGCACTCCTGG + Intergenic
997120251 5:131165806-131165828 AATTCTTTGCAGAGCAGTCTAGG - Intronic
999379341 5:151109443-151109465 AATCCTTAACACAGCACTCTAGG + Intronic
1000836734 5:166164274-166164296 GATTCTTTACAGACTATTCTGGG - Intergenic
1003288392 6:4755491-4755513 CATTCTTAACAGATGACTCTGGG + Intronic
1005795474 6:29356484-29356506 CATTATTAACAGAGAACTCTAGG - Intronic
1006277709 6:33019414-33019436 GATTGATAACAGAGCCCTCTGGG - Intergenic
1007704931 6:43784726-43784748 GACTCTGCGCAGAGCACTTTGGG + Exonic
1008508245 6:52252103-52252125 GGATCCTCACACAGCACTCTGGG - Intergenic
1011479678 6:87781494-87781516 GAATCTTCTCAGAGCCCTCAGGG - Intergenic
1012987581 6:105891455-105891477 AATTCTTCACAAGGCACTTTGGG + Intergenic
1014497877 6:122149683-122149705 TATTCTTCAAAGAACAATCTTGG + Intergenic
1015167845 6:130218662-130218684 GATGCTTTAGAAAGCACTCTGGG + Intronic
1015212476 6:130713941-130713963 GATTCTTCTCAGAACAGTCTGGG - Intergenic
1015685565 6:135855736-135855758 GAGTCTTTAGAGAGCACTATGGG + Intronic
1015797502 6:137027642-137027664 GATTCTTCACATAGAGCTCCTGG + Intronic
1017916706 6:158836862-158836884 GATCCTCCACACAGGACTCTGGG - Intergenic
1021220102 7:17965671-17965693 CATTGTTCACAAAGCATTCTGGG - Intergenic
1028271687 7:88798933-88798955 TATTCTAAACAGATCACTCTGGG - Intronic
1028533034 7:91860049-91860071 GATACTTCACTGAGCATTTTTGG + Intronic
1031240215 7:119228359-119228381 GATGCTTCTCAGAACTCTCTAGG - Intergenic
1032495949 7:132362547-132362569 CATTCTTAACACAGCACTATAGG - Intronic
1034336867 7:150329547-150329569 GTTTCCTCACAGCCCACTCTTGG - Intronic
1034736981 7:153438640-153438662 GGGTCTTCACAGAGCAGTGTGGG - Intergenic
1035909887 8:3554832-3554854 GGCTGTTCACACAGCACTCTTGG - Intronic
1036126334 8:6066222-6066244 GATTCATTTCAGAGCACTGTTGG + Intergenic
1038528165 8:28295091-28295113 GATTCTGCTCAGAGAAATCTTGG + Intergenic
1042745729 8:72103600-72103622 GATTCTTCCCAGAGGGCTCCTGG + Intronic
1045571687 8:103374242-103374264 GATTCTTCCCAGACAACTATTGG + Intronic
1047205184 8:122797448-122797470 GTTTCTGCACAGAGAACCCTGGG + Intronic
1047300901 8:123612790-123612812 TGTGCTTCACAGAGCACTCCAGG - Intergenic
1051759371 9:20444323-20444345 GCTTCTCCACAGAGTACACTTGG + Intronic
1052210522 9:25897604-25897626 GATTCTTCAAAAACGACTCTTGG - Intergenic
1055787020 9:79882053-79882075 GATTTCTCATAGAGAACTCTTGG - Intergenic
1056081575 9:83100291-83100313 GCTTCTTCAGAGAGCATTCAAGG + Intergenic
1060150359 9:121284496-121284518 CACTTATCACAGAGCACTCTGGG - Intronic
1061285089 9:129618030-129618052 CATTCCTCACACAGTACTCTAGG - Intronic
1062271083 9:135709293-135709315 GTGCCTTCACAGAGCAGTCTTGG + Intronic
1187274925 X:17808716-17808738 GATTCTTAGCAGAGGTCTCTGGG - Intronic
1189609842 X:42720598-42720620 CCTTGTTCACAGAGCTCTCTAGG + Intergenic
1201674410 Y:16563107-16563129 AATTCTTCACAGAGAAATGTCGG - Intergenic