ID: 1163838813

View in Genome Browser
Species Human (GRCh38)
Location 19:19593162-19593184
Sequence CTCAAGCGATTCCAAAGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 7, 3: 40, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163838810_1163838813 1 Left 1163838810 19:19593138-19593160 CCAGGTTGGTCTCATACTCTTGG 0: 3
1: 99
2: 2898
3: 30066
4: 104251
Right 1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG 0: 1
1: 1
2: 7
3: 40
4: 132
1163838809_1163838813 2 Left 1163838809 19:19593137-19593159 CCCAGGTTGGTCTCATACTCTTG 0: 3
1: 103
2: 2906
3: 26719
4: 46761
Right 1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG 0: 1
1: 1
2: 7
3: 40
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163838813 Original CRISPR CTCAAGCGATTCCAAAGTAC TGG Intronic
904951833 1:34247822-34247844 CTCAAGCAATCCCAAAGTGCTGG + Intergenic
906089780 1:43169076-43169098 CTCTAGCGAATCCTAAGTAGTGG - Intronic
906271239 1:44480650-44480672 CTCAAGTGATCCCAAAGTGTTGG - Intronic
906527243 1:46501513-46501535 CTTAAGTGATCCCAAAGTGCTGG + Intergenic
912372354 1:109183847-109183869 CTCAAGAGATCCTAAAGTGCTGG + Intronic
912620778 1:111155027-111155049 CTGAAACTATTCCAAAATACTGG - Intronic
915275249 1:154783961-154783983 CTAAAGCGGTTACTAAGTACAGG + Intronic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
922287294 1:224181506-224181528 CTCAAGTGATCTCAAAGTATTGG - Intronic
1063248628 10:4249939-4249961 CTCAAGTAATCCCAAAGTGCTGG + Intergenic
1065535957 10:26714995-26715017 CTCCAGTGATTCCAAAGGTCAGG + Intronic
1069812073 10:71169027-71169049 CTCAAGCACTTCCAAAGTGAAGG + Intergenic
1070302692 10:75215953-75215975 CTCAAGTGATCCCAAAGTGTTGG + Intronic
1070483742 10:76910370-76910392 CTAAAGCTATGCCAAAGGACTGG - Intronic
1073308051 10:102518778-102518800 CTCAAGCCATCCCAAAGTGCTGG + Intronic
1077397106 11:2330146-2330168 CTCAAGTAATCCCAAAGTGCTGG - Intergenic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1083417954 11:62537487-62537509 CTCAAACAATCCCAAAGTGCTGG + Intronic
1083589929 11:63887825-63887847 CTCAAGGAATTCCAAAGGCCTGG - Intronic
1083848419 11:65350743-65350765 CTCAAGAGATCCCAAAGTGCTGG - Intronic
1083978027 11:66139972-66139994 CTCAAGTGGTGCCAAACTACAGG + Intronic
1084373136 11:68758032-68758054 CTCAAGCGATTCCAAAGTGCTGG - Intronic
1085189777 11:74609176-74609198 TTCAAGTGATTCTAAAATACAGG - Intronic
1085234596 11:75004351-75004373 CTCAAGCTATTCTAAAGTGCTGG + Intronic
1085315264 11:75540913-75540935 CTCAGGTGATCCCAAAGTGCTGG + Intergenic
1086102053 11:83110930-83110952 CTCAAGCAATCCCAAAGTGCTGG + Intergenic
1086230397 11:84562515-84562537 CACAAACAATTCCAAAATACAGG - Intronic
1087386237 11:97471908-97471930 CTCCAGTGAGCCCAAAGTACAGG + Intergenic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1090236632 11:125153090-125153112 CTCAAGCAATCCTAAAGTCCTGG + Intergenic
1091598153 12:1894332-1894354 CTCAAGTTATTCCAAAATATTGG + Intronic
1091607533 12:1968113-1968135 CTCAAGTGATCCCAAAGTACTGG - Intronic
1092600673 12:10059671-10059693 CTCAAGGAATCCCAAAGTGCTGG - Intronic
1095729853 12:45494548-45494570 CTTTATCGTTTCCAAAGTACTGG - Intergenic
1096679269 12:53244194-53244216 CTCAAGCGATCCCGGACTACAGG + Intergenic
1096760223 12:53835693-53835715 CTCAAGTGATCCCAAAGTTCTGG + Intergenic
1097777384 12:63664465-63664487 TTCAAGTGATTCTAATGTACTGG + Intronic
1100751105 12:97698937-97698959 CTGAGGTGATTCCAATGTACAGG - Intergenic
1103726984 12:123002649-123002671 CTTAAGCGATCCCAAAGTGTTGG + Intronic
1103806687 12:123579313-123579335 CTCAAGCAGTCCCAAAGCACTGG - Intergenic
1104069539 12:125331990-125332012 CTCAAGCCATCCCAAAGTGCTGG + Intronic
1111813456 13:93120601-93120623 CTCAAGAGAGTCCAAAATACTGG + Intergenic
1112401428 13:99081985-99082007 CTCAAGCAATCCCAAACTCCTGG - Intronic
1112914392 13:104528802-104528824 ACCAAGCGATTCCAAGGCACTGG + Intergenic
1115370747 14:32611357-32611379 CCCAGGTGATTCTAAAGTACAGG + Intronic
1116689865 14:48091835-48091857 CTCAAGCGATCCTAAAATGCTGG - Intergenic
1118834278 14:69465245-69465267 CTCAAGTGATCCCAAAGTACTGG - Intergenic
1119228897 14:72964762-72964784 CTCAAGTGATCCCAAAGTGTTGG - Intergenic
1120983344 14:90310751-90310773 CTCAAGTGATCCCAAAGTGCTGG + Intronic
1121284217 14:92722345-92722367 CTCAAGTGATCCCAAAGTGCTGG - Intronic
1121532387 14:94664566-94664588 CACAAGCTATGCCAAGGTACTGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124997277 15:34736013-34736035 CTCAAGCGAAACCAAAGACCTGG + Intergenic
1128825261 15:70710022-70710044 CTCAAGTGATCCCAAAGTGCTGG - Intronic
1128838291 15:70829067-70829089 CTCAAGCAACTCTAAAGTGCTGG + Intergenic
1129278390 15:74462732-74462754 CTCAGGTGATCCCAAAGTGCTGG + Intergenic
1129867462 15:78920390-78920412 CTCAAGTGATCCCAAAGTGCTGG - Intergenic
1130098318 15:80872579-80872601 CTCAAGTGATCCCAAAGTGTTGG - Intronic
1131774347 15:95778064-95778086 CTCAAGTGATTCCAGAGTCAAGG + Intergenic
1132344754 15:101101430-101101452 CACAAGCGATTCCACATTCCAGG + Intergenic
1135075311 16:19388302-19388324 CTCAAGTGATCCCAAAGTGTTGG - Intergenic
1135192402 16:20365505-20365527 GTGAAGAGATTCCAAAATACTGG - Exonic
1136109429 16:28055384-28055406 CCCAAGGGATCCCAAAGTGCTGG + Intronic
1141732290 16:85830557-85830579 CTCAGGCGATCCCAAATTTCTGG - Intergenic
1143884540 17:10056123-10056145 CTCAAGCGATCTCAAAGTGCTGG - Intronic
1145038734 17:19560643-19560665 CTCAGGTGATCCCAAAGTGCTGG - Intronic
1146077318 17:29743163-29743185 CTCAAGCAATCCAAAAGTGCTGG + Intronic
1146303765 17:31713576-31713598 TGCAAACGATTCCAAAGAACGGG + Intergenic
1149989449 17:61373679-61373701 CTCAAGTGATCCCAAAGTGCTGG + Intronic
1152023281 17:77792983-77793005 AGCAAGGCATTCCAAAGTACAGG + Intergenic
1152859596 17:82688252-82688274 CTCAAGCGATCCCAAAGTGCTGG + Intronic
1155320420 18:24613257-24613279 AGCCAGCGATTACAAAGTACAGG - Intergenic
1155361931 18:25011532-25011554 CCCAGGCGATTTCAATGTACCGG + Intergenic
1155553241 18:26989714-26989736 CTCAAGCAATCCAAAAGTGCTGG - Intronic
1157713628 18:49867048-49867070 GTCAAGAGATTCCAAAATCCAGG + Intronic
1160759948 19:778690-778712 CTCAGGTGATCCCAAAGTGCTGG - Intergenic
1161011954 19:1964048-1964070 CTCAGGTGATCCCAAAGTGCTGG + Intronic
1161450163 19:4341318-4341340 CTCAAGTGATCCCAAAGTGCTGG + Intronic
1163183632 19:15621290-15621312 CTCAAGTGATACCAATGTGCTGG - Intronic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
1167710969 19:51110527-51110549 CTCAAGTGATCCCAAAGTGCTGG + Intergenic
1168600877 19:57717638-57717660 TTCAAGTGATCCCAAAGCACTGG - Intronic
926888881 2:17622262-17622284 CTCAAGGGCTCCCAAAGTGCTGG - Intronic
927537364 2:23874467-23874489 CTCAAGTGATCCCAAAGTGCTGG - Intronic
928070669 2:28212155-28212177 CTCAAGCTATTCCAACTAACAGG - Intronic
928576054 2:32656481-32656503 CTCCAGGCATTCCAAACTACTGG - Intronic
930641955 2:53862345-53862367 CTCAAGCGATCCTAAAGTGCTGG + Intergenic
932725075 2:74172900-74172922 CTCAGGTGATCCCAAAGTGCTGG - Intronic
933989276 2:87622109-87622131 CCCAGGCGATTCCCAAGCACTGG + Intergenic
935416800 2:102827855-102827877 CTCAGGTGATCCCAAAGTGCTGG - Intronic
936304567 2:111328717-111328739 CCCAGGCGATTCCCAAGCACTGG - Intergenic
936416254 2:112315830-112315852 CTCAAATGATCCCAAAGTGCTGG + Intronic
940336329 2:152531707-152531729 CTCAAGTGATCCCAGAGTGCTGG + Intronic
943327155 2:186514563-186514585 CTCAAGCAATCCCAAAGTGCTGG - Intergenic
943992264 2:194711722-194711744 CTCCAGCCTTTCCAAAGTGCTGG - Intergenic
944671909 2:202001455-202001477 CTCAAGCGATCCCAAAGTGCTGG - Intergenic
944699622 2:202235101-202235123 CTCAAGTGATCCCAAAGTGGTGG + Intronic
944726122 2:202473197-202473219 ATCAAGCGATCCCAAAGTGCTGG - Intronic
946015113 2:216598090-216598112 CTCAAGTGACCCCAAAGTGCTGG + Intergenic
947081277 2:226399846-226399868 CTCAATGGATCCCAAAGTTCTGG + Intergenic
948549418 2:238759717-238759739 CTCAAGTGATCCCAAAGTGCTGG + Intergenic
1169577134 20:6976503-6976525 CTCAGACAATTCTAAAGTACAGG - Intergenic
1169839619 20:9920611-9920633 CTCAGGTGATCCCAAAGTGCTGG + Intergenic
1170226135 20:13994059-13994081 CTCAAGTGATCCCAAAGTGCTGG - Intronic
1174817175 20:53697056-53697078 CTCAAGCGATTCCCAAGCCTCGG - Intergenic
1176726395 21:10438160-10438182 CTCCAGTGATCCCAAAGTGCTGG + Intergenic
1179837622 21:44047412-44047434 CTCAAGTGATCCCAAAGTGCTGG + Intronic
1180882803 22:19218533-19218555 CTCAAGCCTTTCGAAAGCACTGG + Intronic
1182382768 22:29906708-29906730 CTCAAGTAGTTCCACAGTACAGG - Intronic
1182959946 22:34462764-34462786 CTCAAAAGATACCAAAGTATGGG - Intergenic
950602946 3:14051143-14051165 CTCAAGCAATCCCAGAGTGCTGG + Intronic
951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG + Intronic
953346779 3:42182524-42182546 CTCAAGTGATCCCAAAGTGCCGG + Intronic
954220430 3:49150298-49150320 GTCAAGCCAGTCCAAAATACAGG + Intergenic
957901387 3:86498043-86498065 CTCTTGAGATTCCAAACTACAGG - Intergenic
960110928 3:113843705-113843727 CTCAAGTGATCCCAAAGTGTTGG + Intronic
962005730 3:131347703-131347725 CTCAGGTGATCCCAAAGTGCTGG - Intronic
970391735 4:15618918-15618940 CTCAAGCACTCCCAAAGTGCTGG - Intronic
973346308 4:49060012-49060034 CTCCACCAATTCCAGAGTACAGG - Intronic
975783176 4:77860828-77860850 TTCAAGCAATCCCAAAGTGCTGG - Intergenic
976931176 4:90568999-90569021 CTCAGGTGATCCCAAAGTGCTGG + Intronic
978148052 4:105400394-105400416 CTCAGGTGATCCCAAAGTGCTGG - Intronic
979726455 4:123968439-123968461 TTCAAGCTTTTCCAAAGTTCTGG + Intergenic
982306999 4:153943281-153943303 CTCATGTGATCCCAAAGTGCTGG - Intergenic
983430376 4:167642551-167642573 CTCAAGTAATCCCAAAGTGCTGG - Intergenic
987048228 5:14127164-14127186 CTCAAGAGATTCTGAGGTACAGG + Intergenic
988869148 5:35369484-35369506 CTCAAGTGATCCCACAGTGCTGG - Intergenic
988950854 5:36258834-36258856 GTCAAGTGATTCCAATGTACAGG - Intronic
989199886 5:38752624-38752646 CACAAGAAATGCCAAAGTACAGG + Intergenic
990460525 5:56027270-56027292 CTTAAGTGATTCCAAAGCACAGG - Intergenic
992693694 5:79263626-79263648 CTCAAGGTGTTCCAAAGTGCTGG + Intronic
995494082 5:112723226-112723248 CTCAAGCGATCCCCAAGTGCTGG - Intronic
998030148 5:138859672-138859694 CTCAAGCGACCCTAAAGTGCTGG - Intronic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
1001340626 5:170841095-170841117 CTCAAGTGATCCCAAAGTGCTGG + Intergenic
1004337631 6:14778678-14778700 CTCTTGCTATTCCAAAGTCCTGG - Intergenic
1006278991 6:33031459-33031481 CACAAGCGATTCCAAAAGACGGG - Intergenic
1006293087 6:33155563-33155585 CCCAGGCAATTCCAAAGTGCAGG - Intergenic
1006549824 6:34812701-34812723 TTCAAGCAGTTCCAAAGTGCTGG + Intronic
1006632667 6:35440593-35440615 CTTAAGCGATCCCAAAGTGCTGG + Intergenic
1007675862 6:43594471-43594493 CTCAAGGGCTCCCAAAGTGCTGG - Intronic
1011895567 6:92220426-92220448 CTCAGGTGATCCCAAAGTGCTGG + Intergenic
1013244438 6:108273442-108273464 CTCAAGTGATCCCAAAGTTCTGG - Intergenic
1015410107 6:132884833-132884855 CTCAAGCGATCCCAAAGTGCTGG - Intergenic
1016086012 6:139915921-139915943 CTCAAGAGATCCCAAACTACTGG - Intergenic
1017477626 6:154814086-154814108 CTCAAGTAATTTCAAAGTGCTGG - Intronic
1018523531 6:164680105-164680127 TTCAAAGGATTCCAAAGTTCAGG + Intergenic
1020210691 7:6155988-6156010 CTCAAGCGATCCCAAAGCACTGG + Intronic
1021180216 7:17497380-17497402 CCCAAGGGATTCCAGTGTACAGG - Intergenic
1022568473 7:31427567-31427589 CTCAGGTGATTTCAAAGTGCAGG + Intergenic
1022730531 7:33019018-33019040 CTCAAGCGATCCCAAAGTGCTGG - Intronic
1025168503 7:56734992-56735014 CTCAAGCAAACCCAAAGTACTGG - Intergenic
1025703883 7:63844895-63844917 CTCAAGCAAACCCAAAGTACTGG + Intergenic
1030230728 7:107205845-107205867 CTTCAGGGATTCCAAAGTGCCGG - Intronic
1031357277 7:120802226-120802248 CACAGGTGATTCCAAAGAACAGG + Intronic
1032374977 7:131404542-131404564 CTCAAATGATCCCAAAGCACTGG + Intronic
1034603711 7:152289811-152289833 CTCCAGTGATCCCAAAGTGCTGG - Intronic
1037837942 8:22225239-22225261 CTCAAGTGATCCCAAAGTGCTGG - Intronic
1039320240 8:36422070-36422092 CTCAATCAATCCCAAAGTGCTGG - Intergenic
1044319826 8:90790086-90790108 CCCAGGTGATTCCAATGTACAGG + Intronic
1044338543 8:91019324-91019346 TTCAAGTGATCCCAAAGTGCTGG - Intronic
1044479245 8:92666160-92666182 CTCAAGTGATCCCAAAGTGCTGG + Intergenic
1044812895 8:96082143-96082165 CTCAAGTGATCCCAAAGTGCTGG + Intergenic
1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG + Intergenic
1047538198 8:125738527-125738549 TTCAAGCAATTCCAAGATACAGG + Intergenic
1049452876 8:142671779-142671801 CTCAAGCGATCCCAAAATGCTGG + Intronic
1049568149 8:143353728-143353750 CTCAAGTGATCCCAAAGTGTTGG - Intronic
1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG + Intergenic
1055904683 9:81278945-81278967 CACAAGAGATTCCAAAGTCATGG - Intergenic
1056292630 9:85159021-85159043 CTCAAGGGATTTCAATGTGCAGG - Intergenic
1058734625 9:107883116-107883138 CTCATACAATTCCAAAGTGCAGG - Intergenic
1059472628 9:114517894-114517916 CTCAAGTGATCCCAAAGTGCTGG + Intergenic
1059999342 9:119944140-119944162 CTCAAGCTATTTCAAAGAAGAGG - Intergenic
1185949584 X:4416714-4416736 CTGAAGAGATTCCAATGTGCTGG - Intergenic
1185989654 X:4879012-4879034 CTCAAGGGATTCTTATGTACAGG + Intergenic
1186990156 X:15058217-15058239 CGCCAGGGATTCTAAAGTACAGG + Intergenic
1190263742 X:48815592-48815614 CTCAAGGGCTTCCAGAGCACAGG - Exonic
1193913847 X:87341274-87341296 CTCAAGTGATCTCAAAGTGCTGG - Intergenic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1196812449 X:119639589-119639611 CTCAGGGGCTTCCAAGGTACTGG - Intronic
1198815866 X:140589474-140589496 CTCAAGAGTTTCAAAAGTATTGG - Intergenic