ID: 1163839158

View in Genome Browser
Species Human (GRCh38)
Location 19:19595343-19595365
Sequence CCCCAAGTACTGCAGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163839158_1163839165 -6 Left 1163839158 19:19595343-19595365 CCCTCAGCCTGCAGTACTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1163839165 19:19595360-19595382 TTGGGGCTCATTCGGGTACAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1163839158_1163839164 -7 Left 1163839158 19:19595343-19595365 CCCTCAGCCTGCAGTACTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1163839164 19:19595359-19595381 CTTGGGGCTCATTCGGGTACAGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163839158 Original CRISPR CCCCAAGTACTGCAGGCTGA GGG (reversed) Intronic
900459608 1:2796547-2796569 CCCCAAGTGTTGCAGGCTTGGGG - Intronic
900569292 1:3350535-3350557 CCCCTTGTCCTGCAGGCTGCTGG - Intronic
902042425 1:13502510-13502532 CCACAAGAACTGCTTGCTGATGG - Intronic
902460958 1:16576308-16576330 CTCCAAGAACAGCTGGCTGAGGG - Exonic
902461739 1:16582585-16582607 CTCCAAGAACAGCTGGCTGAGGG - Exonic
902462519 1:16588890-16588912 CTCCAAGAACAGCTGGCTGAGGG - Exonic
903828161 1:26159742-26159764 CCCTGAGTCCTGGAGGCTGAGGG - Intronic
904475541 1:30762383-30762405 CCACAGGCACTGCAGGCTGAAGG + Intergenic
908595416 1:65684091-65684113 TCCTGAGTACAGCAGGCTGATGG + Intergenic
911350545 1:96748240-96748262 AACCAAGGACTGAAGGCTGAGGG - Intronic
913602952 1:120439627-120439649 CTCCAAGAACAGCTGGCTGAGGG + Intergenic
913603700 1:120445980-120446002 CTCCAAGAACAGCTGGCTGAGGG + Intergenic
913604463 1:120452268-120452290 CTCCAAGAACAGCTGGCTGAGGG + Intergenic
913640566 1:120808696-120808718 CTCCAAGAACAGCTGGCTGAGGG + Exonic
913641338 1:120814980-120815002 CTCCAAGAACAGCTGGCTGAGGG + Exonic
913990609 1:143608333-143608355 CTCCAAGAACAGCTGGCTGAGGG - Intergenic
914084077 1:144436936-144436958 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914190099 1:145402208-145402230 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914211957 1:145587928-145587950 CTCCAAGAACAGCTGGCTGAGGG - Intergenic
914277147 1:146135348-146135370 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914277911 1:146141645-146141667 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914364131 1:146963246-146963268 CTCCAAGAACAGCTGGCTGAGGG + Exonic
914364895 1:146969533-146969555 CTCCAAGAACAGCTGGCTGAGGG + Exonic
914365657 1:146975828-146975850 CTCCAAGAACAGCTGGCTGAGGG + Exonic
914486786 1:148117613-148117635 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914487547 1:148123894-148123916 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914538192 1:148586296-148586318 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914538956 1:148592593-148592615 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914587114 1:149072759-149072781 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914587895 1:149079048-149079070 CTCCAAGAACAGCTGGCTGAGGG - Exonic
914627723 1:149479031-149479053 CTCCAAGAACAGCTGGCTGAGGG + Intergenic
916240546 1:162634719-162634741 CCCAAAGCAGTGCAGGCTGAAGG + Intronic
916805047 1:168250952-168250974 CCCTAATCACTGCAGGCTCAGGG + Exonic
919051792 1:192520559-192520581 CCCCAACTGCTGCTGTCTGAGGG + Intergenic
919140320 1:193562297-193562319 ACCCAAGGAATGCAGGTTGATGG + Intergenic
920388154 1:205582276-205582298 CCCCATGAAGTGCAGGCTGGAGG + Intronic
921826244 1:219675076-219675098 CCAGAAGTACTGAAGGCTGTGGG - Intergenic
922784025 1:228274185-228274207 CGCCAAGTTCTGCCGGCTGCTGG + Exonic
1062931464 10:1355272-1355294 CCCCAAGGGCTTTAGGCTGATGG - Intronic
1063083086 10:2786970-2786992 CCTCAAGGACTGCAAGCTGCAGG + Intergenic
1063339735 10:5252193-5252215 CCTTAAGTAGTTCAGGCTGATGG - Intergenic
1063373669 10:5538725-5538747 CTCCCAGTTCTGCAGCCTGAAGG - Intergenic
1065471940 10:26091092-26091114 GCCCAAGAATTGCAGGCTGTAGG + Intronic
1067348994 10:45458765-45458787 CCCCAGATACTTGAGGCTGAGGG - Intronic
1069714882 10:70514249-70514271 CCCCAGGGATTGCAGGCTGAAGG + Intronic
1069724349 10:70567607-70567629 CCCCAAGGAGTGCTAGCTGAGGG + Exonic
1070344597 10:75529565-75529587 TCCCAACCACTCCAGGCTGATGG - Intronic
1070388972 10:75952119-75952141 CCCCATGTACTTGGGGCTGAGGG - Intronic
1076778156 10:132709479-132709501 CCCCAGGCAGTGCAGGCTGCAGG + Intronic
1077209664 11:1363406-1363428 CCCAAAGTCCTACAGGGTGAAGG + Intergenic
1078973046 11:16437190-16437212 CCCCAAGAGCTCAAGGCTGAAGG + Intronic
1081578531 11:44334841-44334863 CCCCAATTACTTCTGGCTGGGGG + Intergenic
1084604546 11:70164924-70164946 CCCCAAGCACAGCAGCCTGTAGG + Intronic
1088532085 11:110821323-110821345 TACCAAGATCTGCAGGCTGATGG - Intergenic
1089700934 11:120243346-120243368 CCCCACAGGCTGCAGGCTGAGGG - Intronic
1090285704 11:125497049-125497071 CCCCAAGTACTTTTGTCTGATGG + Exonic
1091229087 11:133976242-133976264 CCCCAGGGACTCCAGGCTGGTGG - Intergenic
1092054415 12:5496993-5497015 CCCCTAAAACAGCAGGCTGAGGG + Intronic
1097396991 12:59087271-59087293 CCCCAGGCACTGCAGACAGAAGG - Intergenic
1099134949 12:78885647-78885669 GGCCAGGTGCTGCAGGCTGAGGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099956063 12:89353538-89353560 CCGCAAGACCTGCAGGCTGCGGG + Intergenic
1100315019 12:93437224-93437246 TCCCAGATACTGGAGGCTGAAGG + Intronic
1102261939 12:111448181-111448203 CTCCAGGTGCTGCAGGCTGTTGG - Exonic
1103527141 12:121576628-121576650 CCCAAAGTCCTGGAGGATGAAGG + Intronic
1103621093 12:122187759-122187781 CCCCAAGTGCTGCAGGCCGGCGG - Exonic
1104991389 12:132625642-132625664 CACCAGGTCCTGCAGGGTGAAGG + Exonic
1106414940 13:29538597-29538619 CCCCAGGATCTGCAGGCTCAGGG + Intronic
1111712880 13:91839628-91839650 CCCAAAGCATTGCAGGATGAAGG - Intronic
1113109292 13:106805043-106805065 CACTAAATACTGCAGGCTGCAGG + Intergenic
1113951160 13:114071645-114071667 CAAAAAGAACTGCAGGCTGAGGG - Intronic
1118708703 14:68502488-68502510 CCCCAAGCACTGCTGGGAGAGGG + Intronic
1118924346 14:70178151-70178173 CCCCAAGAAATGAAAGCTGAAGG + Intronic
1119411268 14:74432279-74432301 CCCCAAGCACTGCTTGCTGCTGG - Intergenic
1121123855 14:91393344-91393366 CCCCCAGCCCTGCAGGCAGAGGG + Intronic
1121124715 14:91398834-91398856 CCCCCAGGGCTGCAGGCTGCTGG - Intronic
1121299725 14:92860904-92860926 GCCCAAGTACTTCATTCTGAGGG + Intergenic
1122133748 14:99620755-99620777 CCCTACGTTCTGCAGGCAGAGGG - Intergenic
1122344912 14:101052434-101052456 CTTCAAGTACCGAAGGCTGACGG - Intergenic
1123061539 14:105596928-105596950 CCCCCATTTCTGCAGCCTGAAGG - Intergenic
1123085989 14:105717839-105717861 CCCCCATTTCTGCAGCCTGAAGG - Intergenic
1124987675 15:34637955-34637977 CCCAAAGCATTGCAGGATGAAGG - Intergenic
1127288604 15:57551354-57551376 CCCTTAGAACTGGAGGCTGAAGG - Intergenic
1128675267 15:69603855-69603877 CCCCAAGCACTTCAGGCTCAGGG - Intergenic
1132635181 16:940767-940789 CCGGAAGTACTGCAGGGTAAAGG + Intronic
1134141273 16:11721655-11721677 ACCCGAGTACTCCAGGCTGCAGG + Exonic
1134757297 16:16679224-16679246 TCCCAACTACTGTAGGCTGTAGG - Intergenic
1134988772 16:18679942-18679964 TCCCAACTACTGTAGGCTGTAGG + Intergenic
1136384097 16:29911930-29911952 CCCCAAGCCCTGCAGGGTGGAGG - Intronic
1136605314 16:31329826-31329848 CACCAAGAACACCAGGCTGATGG - Exonic
1136611799 16:31371106-31371128 CCCAAAATACTGCAGCCTGGAGG - Exonic
1136618497 16:31412860-31412882 CCCAAAATACTGCAGCCTGGGGG - Exonic
1137670651 16:50276317-50276339 CCCCCAGTGCTGCTGGCTCATGG + Intronic
1137814805 16:51388580-51388602 CCCCAAGGACTGCCTGGTGAGGG - Intergenic
1137892186 16:52174398-52174420 CCCTCAGCACTGCAGGCTCAGGG + Intergenic
1140215176 16:73001244-73001266 CCCCAAGAGCTGCTGGCTGGAGG - Intronic
1142247719 16:88977399-88977421 CCCCAGATACCCCAGGCTGAAGG - Intergenic
1142827885 17:2525575-2525597 CCCCAAGCCCTGCAGGGAGAGGG - Intergenic
1147747922 17:42706989-42707011 CACCAAGTTCTGCAAGCTGTGGG + Intronic
1149298839 17:55285683-55285705 CACAGAGTGCTGCAGGCTGAAGG - Intronic
1149663368 17:58348489-58348511 CCCCCAGCCCTGCAGCCTGATGG + Intronic
1149812150 17:59686499-59686521 CCCCAACTCAGGCAGGCTGAAGG - Intronic
1151460996 17:74253821-74253843 CCCCAATTACCGTAGGCGGAGGG - Exonic
1151967602 17:77439545-77439567 GCCCAAGTCCTGCAAGCTGCTGG - Intronic
1154071847 18:11159802-11159824 GCCCCAGGACAGCAGGCTGATGG + Intergenic
1157877742 18:51289449-51289471 CCCCAATTTCTGAATGCTGATGG + Intergenic
1158482660 18:57835693-57835715 CCCCAAGTTCAGCAGGAGGATGG - Intergenic
1159895587 18:73992622-73992644 CCCCAACTGCTGCTGGCTGTAGG + Intergenic
1160005921 18:75069085-75069107 CCCCCAGGTCTGCAGGCTGGGGG + Intergenic
1160030044 18:75250036-75250058 CCCCACCTACTGCAGGAGGAAGG - Intronic
1161722174 19:5909109-5909131 TCCCAAACACTGCAGGCTGGAGG - Exonic
1162895516 19:13762906-13762928 CCCCAAGTGCAGCAGCCCGAGGG + Exonic
1163034012 19:14561308-14561330 CCCCAAGAATTGCTGGCTGGTGG + Intronic
1163839158 19:19595343-19595365 CCCCAAGTACTGCAGGCTGAGGG - Intronic
1166046260 19:40232829-40232851 CCCCACGTTCTGCAGCCTTAAGG - Exonic
1166141603 19:40808186-40808208 CCCCAAGTCCTGCATCCTGGTGG - Exonic
1168098393 19:54128299-54128321 CCCCAGGTACCGCAAGATGAAGG + Exonic
1202677389 1_KI270711v1_random:20048-20070 CTCCAAGAACAGCTGGCTGAGGG - Intergenic
1202678175 1_KI270711v1_random:26332-26354 CTCCAAGAACAGCTGGCTGAGGG - Intergenic
926977391 2:18528957-18528979 CCCCTAGAACTGCATGCAGAAGG - Intergenic
927104072 2:19809270-19809292 CCCCAAGTCCTCCAGCCTCAGGG + Intergenic
927700491 2:25265241-25265263 CCCCAACAACTGCAGGCCGGGGG + Intronic
927893661 2:26767919-26767941 TCCTAAGTTCTGCAGGCTGTAGG + Intronic
932261638 2:70332250-70332272 CCCCTAGTCCTGCCAGCTGAGGG + Intergenic
932262212 2:70336518-70336540 TCCCAGCTACTGGAGGCTGAAGG + Intergenic
935086189 2:99847631-99847653 CCCCAAGTTCTACAAGCAGAAGG - Intronic
935764404 2:106351288-106351310 CTCAAAGTTCTGGAGGCTGAAGG - Intergenic
936486528 2:112930432-112930454 CTCCAAGTCCTGCAGGCTTAGGG - Intergenic
944091109 2:195912776-195912798 CCCCCAGTATTGGAGGTTGAAGG - Intronic
945802444 2:214450218-214450240 CCAGAACTCCTGCAGGCTGACGG + Intronic
945933939 2:215884020-215884042 CCCCAAATGCAGCAGCCTGAGGG - Intergenic
947153211 2:227135325-227135347 CCCTAAGAGCTCCAGGCTGAGGG - Intronic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1170858073 20:20076043-20076065 CCCCAAGTCCAGCAGTCTTAGGG + Intronic
1170909627 20:20552677-20552699 CCACAAGTACTGCAGGATCGTGG - Intronic
1171179139 20:23079124-23079146 CCCCAAGGGCAGCACGCTGAGGG + Intergenic
1174813212 20:53665188-53665210 CCCAATGCACTCCAGGCTGAGGG - Intergenic
1175992118 20:62794717-62794739 CCACAATTACTGCAGGCATAGGG - Intergenic
1176382396 21:6119902-6119924 ACCCCAGTGCTGCAGGCTCAGGG + Exonic
1176649679 21:9533671-9533693 CCCCAAGAACTTCAGGCAGACGG + Intergenic
1177125116 21:17184593-17184615 CTCAAAGGACAGCAGGCTGAGGG + Intergenic
1177802162 21:25838756-25838778 ACCCAAGTAATCCAGGATGATGG + Intergenic
1179741076 21:43418337-43418359 ACCCCAGTGCTGCAGGCTCAGGG - Exonic
1181046380 22:20216254-20216276 CCCCCAGGGCTGCAAGCTGATGG - Intergenic
1181562244 22:23712351-23712373 TCCCAAGTACTTGGGGCTGATGG - Intergenic
1184257801 22:43296960-43296982 CCCCCAGCTCTGCGGGCTGAAGG - Intronic
1185248341 22:49785413-49785435 CTCCAAGTTCTGCATGCAGAGGG + Intronic
950424331 3:12916525-12916547 CCCCAAGCACTGCAGCCTTTTGG - Intronic
951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG + Exonic
952335655 3:32401375-32401397 CCCAAAGTCCTCCAGGCTGCAGG + Intronic
952652137 3:35739351-35739373 CCCCGAGGACTGCCGGCTCAGGG - Exonic
955404015 3:58613923-58613945 TCCCAGGTACAGCAGGCTGCAGG - Intronic
955443232 3:58979244-58979266 CCCCAAGTACTACAGGCTAATGG - Intronic
957118399 3:76057220-76057242 TCCCAGGCACTGCAGGCTGTGGG - Intronic
962176257 3:133158719-133158741 CTCCAAGTACTGCTGGAAGATGG - Intronic
967978382 3:195048293-195048315 GCCCCAGTGCTGCAGGCTGATGG - Intergenic
970542559 4:17094493-17094515 ACCAAAGAAATGCAGGCTGAAGG + Intergenic
971174657 4:24270235-24270257 TCCCAAGAGCTGCAGTCTGAAGG - Intergenic
974178986 4:58360551-58360573 CACCAAGGACTGCAGGTTGATGG - Intergenic
978497693 4:109377746-109377768 CCCCACCTCCTGCAGGCTGAGGG + Intergenic
978993359 4:115116037-115116059 CACTAAGTACTGAAGGCAGAGGG + Intergenic
981341132 4:143622845-143622867 TCCCAAGTAATGAAGGCTCATGG - Intronic
983585673 4:169351970-169351992 CCCCAAGTTGTGCAGTCTGATGG - Intergenic
984440186 4:179759688-179759710 CCTCAAGTTTTTCAGGCTGAAGG - Intergenic
985353780 4:189095813-189095835 ACACAAATACTGCAGGCTGGAGG + Intergenic
985839739 5:2297508-2297530 CGCGAAGGACTGCTGGCTGATGG - Intergenic
991380781 5:66023283-66023305 GCTCAAGTACTTCAGGCTGTTGG - Exonic
994424174 5:99563071-99563093 CCGCAAGTGCTGCTGCCTGATGG + Intergenic
997827087 5:137116118-137116140 CCACATCTCCTGCAGGCTGATGG + Intronic
1004127810 6:12890358-12890380 TCCCCAGTACTGCAGCCAGAGGG + Intronic
1006093346 6:31641146-31641168 CCCCAAGCAGTGCAGGTTTAGGG + Exonic
1007302152 6:40875658-40875680 TCCCAAGCACTGCAGCCTGTAGG + Intergenic
1007387715 6:41530868-41530890 CCCCAACTCCTGCAGACTGTGGG - Intergenic
1007687223 6:43674056-43674078 CCCCAAGAGCTGCTGGCAGATGG + Intronic
1007918425 6:45584433-45584455 CCCCCTGCACTCCAGGCTGAGGG - Intronic
1008877088 6:56340956-56340978 CCCCTAGTACTGTAGGCATAAGG - Intronic
1010351740 6:74883107-74883129 ACCCAAGTACTGTTGGCTGTGGG + Intergenic
1013375450 6:109509922-109509944 CCCCAACCCCTGCAGGCTCAGGG + Intronic
1015406718 6:132845691-132845713 TCCCAAGATCTGCAGTCTGAAGG - Intergenic
1018966557 6:168494907-168494929 CCCCAGGAACTGCAGGCAGAGGG - Intronic
1019256200 7:53726-53748 CCCCAAGTGCAGCAGGCGGGAGG + Intergenic
1021214675 7:17901260-17901282 CCCCAAGTAGTGCAGCTTGCAGG - Intronic
1022127451 7:27372175-27372197 GCTCAAGTTCTGCAGGCTGTAGG + Intergenic
1023153484 7:37224301-37224323 CCTCAAAGACTGCAGGCTGCAGG + Intronic
1025093587 7:56081669-56081691 CACCAAGTACTGCTGGAAGAAGG + Exonic
1025216603 7:57061215-57061237 CACCACGTACTGCAGGAAGAAGG + Intergenic
1025654776 7:63509515-63509537 CACCACGTACTGCAGGAAGAAGG - Intergenic
1028886287 7:95938057-95938079 CCCCAAGTTTTGCACGCTTAAGG - Intronic
1031264392 7:119565962-119565984 CCCCAAATACTGCAATATGATGG + Intergenic
1033195252 7:139321882-139321904 CCCCACGGACTCCAGGCTGGAGG + Intergenic
1039843982 8:41312632-41312654 TCCCTAGTGCTGCTGGCTGAGGG - Intergenic
1041551071 8:59102266-59102288 CCCACTGTACTGCAGGCTGGGGG - Intronic
1041789235 8:61673327-61673349 CCCAAAGCAAGGCAGGCTGAAGG + Intronic
1045947685 8:107814882-107814904 CCATAAGTCCTGCAGTCTGAAGG - Intergenic
1048623262 8:136158185-136158207 ATCCAAGTGCTGCAGGCAGAGGG - Intergenic
1050483489 9:6110159-6110181 CCACAAGTTCTGCAGCCCGAAGG - Intergenic
1055282387 9:74689422-74689444 CCCCAAAGACTGAAAGCTGAAGG + Exonic
1056626612 9:88258861-88258883 ACCCCAGTTCTGCAGGCTGTGGG - Intergenic
1056936058 9:90915506-90915528 GCCCAAGGACTCCAGGCTGGAGG - Intergenic
1057006477 9:91565348-91565370 CATCAAATCCTGCAGGCTGAGGG + Intronic
1057307563 9:93921038-93921060 TCCCAGGTACTGGAGTCTGAGGG + Intergenic
1057857139 9:98610336-98610358 CCTCACGTAGTGCAGGCTGTGGG - Intronic
1060522437 9:124301325-124301347 GCCCAAGCCCTGGAGGCTGAGGG + Intronic
1061435837 9:130561309-130561331 CCCAAAGGACTCCAGGCTCAAGG - Intergenic
1061741417 9:132708942-132708964 CCTCAAAATCTGCAGGCTGAAGG + Intergenic
1061747128 9:132748681-132748703 CCCCAAGTACCACGGGCAGATGG - Intronic
1061756293 9:132814796-132814818 CCCCCAGTGCTGCCTGCTGAGGG + Intronic
1062012282 9:134273599-134273621 CCCCACTCACTGCAGGCTGTAGG + Intergenic
1203627420 Un_KI270750v1:37219-37241 CCCCAAGAACTTCAGGCAGACGG + Intergenic
1185610010 X:1388694-1388716 CCCACAGTCCTGCAGGCTGAAGG - Intronic
1188098939 X:26058316-26058338 CCCCAAGTACTTCATGGGGAGGG - Intergenic
1188209191 X:27398980-27399002 CCGGAAGTTCTACAGGCTGAGGG + Intergenic
1188412436 X:29890403-29890425 CCCCAACCACTGCAGCCTGGCGG - Intronic
1190444920 X:50514859-50514881 CCCCCATTTCTGCAGGCTCAGGG - Intergenic
1193524029 X:82566730-82566752 CCCCCAGTACAGCGGGCTGCGGG + Intergenic
1197113913 X:122808968-122808990 AACCAAGTACTGCAGACTGGTGG - Intergenic
1198140357 X:133796621-133796643 CCCCAAGTAATTGAGGCAGAGGG - Intronic
1198699546 X:139382458-139382480 CCCCAGTTCCTGCAGGCTCAGGG - Intergenic