ID: 1163839347

View in Genome Browser
Species Human (GRCh38)
Location 19:19596586-19596608
Sequence GATTTACTCTGAAAGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163839343_1163839347 6 Left 1163839343 19:19596557-19596579 CCAACAGCAATGAGCACATCAAA 0: 1
1: 0
2: 7
3: 40
4: 317
Right 1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG 0: 1
1: 0
2: 0
3: 9
4: 201
1163839340_1163839347 23 Left 1163839340 19:19596540-19596562 CCAAGAGCAGCAACACCCCAACA 0: 1
1: 0
2: 1
3: 22
4: 161
Right 1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG 0: 1
1: 0
2: 0
3: 9
4: 201
1163839341_1163839347 8 Left 1163839341 19:19596555-19596577 CCCCAACAGCAATGAGCACATCA No data
Right 1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG 0: 1
1: 0
2: 0
3: 9
4: 201
1163839342_1163839347 7 Left 1163839342 19:19596556-19596578 CCCAACAGCAATGAGCACATCAA 0: 1
1: 1
2: 6
3: 70
4: 334
Right 1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG 0: 1
1: 0
2: 0
3: 9
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163839347 Original CRISPR GATTTACTCTGAAAGGAATC AGG Intronic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
901866328 1:12109399-12109421 GCTTTACTCTGAAGGGGAACGGG + Intronic
905702737 1:40030719-40030741 GATTTAATCTGGAAGGATTAGGG - Intergenic
906485538 1:46231837-46231859 AACTAATTCTGAAAGGAATCAGG - Intergenic
915769902 1:158410012-158410034 GATTTATTCTGGAAGAAATTGGG + Intergenic
917018879 1:170564488-170564510 GTTTTCCCCTGAAAGGAAACAGG + Intergenic
917204722 1:172560609-172560631 GATTAATTCTGGCAGGAATCAGG - Intronic
917260605 1:173163565-173163587 AATATAATCTGAAAGGGATCTGG - Intergenic
917265196 1:173213784-173213806 GATTTATTCTGAAAAGAAGAGGG - Intergenic
917917722 1:179721052-179721074 GACTTACAATGAAAGGCATCTGG - Intergenic
919394916 1:197034223-197034245 CATTTTTTCTCAAAGGAATCAGG + Intergenic
921280796 1:213565585-213565607 GATTGACTTTGAAGGGAATAGGG + Intergenic
921694513 1:218192193-218192215 TGTTTACTATGAAAGAAATCAGG + Intergenic
922083143 1:222317738-222317760 GTTTTACTCTGAACTGAACCTGG - Intergenic
923870260 1:237985184-237985206 AACTTACTCTGAAATGGATCAGG - Intergenic
924012636 1:239682293-239682315 GAATTTCTTTGAAAGGATTCAGG + Intronic
1063246319 10:4223374-4223396 GATTTACCATAAAAGCAATCAGG + Intergenic
1064064038 10:12165191-12165213 GATTTAAACAGAAAAGAATCGGG - Intronic
1064129564 10:12696929-12696951 GATCTACTTTGAAAGGATCCAGG - Intronic
1064441459 10:15357473-15357495 GATTTACTAGGAAGGGAATGAGG + Intronic
1065357650 10:24858061-24858083 GTTTTACTGTGAAATGAATTTGG + Intronic
1067012175 10:42724495-42724517 CATTCACTCTAAAAGAAATCAGG + Intergenic
1067311418 10:45117398-45117420 CATTCACTCTAAAAGAAATCAGG - Intergenic
1067382923 10:45791842-45791864 CATTTATTCTGAAAGAAAACAGG + Intronic
1067890624 10:50132387-50132409 CATTTATTCTGAAAGAAAACAGG + Intronic
1068672303 10:59735480-59735502 AATTAAGTGTGAAAGGAATCTGG - Intronic
1069347961 10:67492190-67492212 CATTTACTCTGACAGGAACTGGG + Intronic
1069420981 10:68246421-68246443 GATTTACTCTAAAATAATTCAGG + Intergenic
1071808073 10:89146044-89146066 GATTTACTCTGTAGGCAATTGGG - Intergenic
1076205776 10:128601066-128601088 GATTTACTTGGAAATGAATTTGG + Intergenic
1078016924 11:7623151-7623173 GGTTTTCTCTGCAGGGAATCAGG - Intronic
1078387155 11:10902686-10902708 GACTTTCTCTGAAAAGAAGCAGG - Intergenic
1078822852 11:14899540-14899562 GATTTACTCTGAAATAAGTGGGG + Intergenic
1079373407 11:19871321-19871343 CATTTACACTGGAAGGAATGAGG - Intronic
1083044585 11:59722284-59722306 GGGTTAATCTGAAAGGATTCCGG - Intronic
1083411004 11:62492343-62492365 GATCTACTGTGTAAGGCATCAGG - Intronic
1085658441 11:78339225-78339247 GATTTGTCATGAAAGGAATCAGG - Intronic
1088092305 11:106057200-106057222 GATTTACTCTAAAGGCAATAAGG + Intronic
1093268673 12:17029959-17029981 GATTTAGTTTTAAAGGAAACCGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1097743774 12:63276775-63276797 AATTTAGTCTGAATGGGATCAGG - Intergenic
1097760665 12:63460181-63460203 GATTTACTGAGAAAGAATTCAGG + Intergenic
1098300574 12:69049839-69049861 GTTTTAATCTGAAAGGATGCTGG - Intergenic
1101704428 12:107208427-107208449 CATTTCCTCTGAAGGGAACCAGG + Intergenic
1103452972 12:121042495-121042517 GCTTTACTCTGAATGAAATGGGG + Intergenic
1105581370 13:21699601-21699623 GACTTACTCTGCAAGGAGTTGGG + Intronic
1106832654 13:33601919-33601941 CATTCTCTCTGAAAGGAACCTGG - Intergenic
1108299200 13:49057168-49057190 GATTTACCTTCAAATGAATCTGG - Intronic
1109856149 13:68130329-68130351 GATTCTCTCTGAAGGGAATGGGG + Intergenic
1111292664 13:86188244-86188266 GACAGACTCTGGAAGGAATCTGG + Intergenic
1111700913 13:91687366-91687388 AATTTTCTCTAAAAGGAATGTGG + Intronic
1112665690 13:101570422-101570444 CATTTTCACTAAAAGGAATCAGG - Intronic
1116266782 14:42701753-42701775 AATTTACTTTGAAACAAATCTGG + Intergenic
1117725627 14:58670248-58670270 GAATGTCTCTGAAGGGAATCTGG + Intergenic
1118170480 14:63384122-63384144 GACTGAATCTGAAAGGAATTTGG - Intronic
1118467257 14:66042210-66042232 CTTTTACTCTGAATGAAATCAGG + Intergenic
1118935670 14:70285586-70285608 GATTCACTCTGGAATGACTCTGG - Intergenic
1119403883 14:74383544-74383566 GATTGCCTCTTAAAGGAATAAGG + Intergenic
1119984142 14:79116588-79116610 TATTCACTCTGAAAGGAGGCTGG - Intronic
1121836605 14:97098016-97098038 GATTTAACCTCAAAGGCATCTGG + Intergenic
1127529502 15:59829743-59829765 GGTTTCCCCTGAAAGAAATCTGG + Intergenic
1128893863 15:71355332-71355354 GTCTTGCTCTGAAAGGCATCAGG - Intronic
1128998390 15:72313530-72313552 GCTTTACCCTGAAAGGAAATGGG - Intronic
1132109835 15:99094585-99094607 GGTTTACTCTAAAAGAAATGGGG + Intergenic
1133908531 16:10043375-10043397 GATTTGCTCAGAAAGGCAGCCGG + Intronic
1135557632 16:23450373-23450395 GCTTTACTCAGAATAGAATCTGG - Intronic
1137857793 16:51813547-51813569 GATAAACACTGAAAGGAAGCAGG + Intergenic
1139221395 16:65186150-65186172 CATTTACTTTGAATGGAATAAGG - Intergenic
1139235531 16:65334523-65334545 GATTTAAATTGAAAGAAATCAGG - Intergenic
1142027645 16:87823120-87823142 GATTTAATCTGGAATGAAGCTGG + Intergenic
1144088871 17:11835476-11835498 AATTTACTCTGGAAGGAAGGTGG + Intronic
1149467465 17:56891369-56891391 GATTTTCTCTAAGAGGAATCGGG + Exonic
1150188341 17:63210743-63210765 GATTTGCTCTTAAAATAATCAGG + Intronic
1151503071 17:74504858-74504880 GCTTTACTTTCAAAGGAAGCTGG + Intergenic
1152454294 17:80404249-80404271 GCTTTACTTCCAAAGGAATCTGG + Intergenic
1153881352 18:9424315-9424337 GCTTTACTTTCAAAGGAAGCTGG - Intergenic
1154567053 18:15911493-15911515 GATTTTCTCTGAAGACAATCCGG - Intergenic
1154715453 18:17945259-17945281 GATTTTCTCTGAAGACAATCCGG - Intergenic
1155021672 18:21902313-21902335 GATTTATTTTGTAAGGATTCAGG + Intergenic
1155518546 18:26646616-26646638 GTGTGACTCTAAAAGGAATCTGG + Intronic
1155581556 18:27313954-27313976 GATTTATTATAAAAGGAAACAGG - Intergenic
1155724402 18:29061613-29061635 TTTTTATTCTGAAAGGAATAGGG - Intergenic
1156541175 18:37912367-37912389 GATTTAATTAGAAAGTAATCAGG + Intergenic
1157348411 18:46861956-46861978 GATTTAATATTAAAGGAAACAGG + Intronic
1158076869 18:53540590-53540612 AATTAAATCTGAAAGGACTCTGG - Intergenic
1158480462 18:57817255-57817277 CATTTGCTCTGGAAGGAGTCAGG + Intergenic
1158762252 18:60403642-60403664 GTTTTACTCTGAAAGAAATACGG + Intergenic
1161006410 19:1939327-1939349 GATTAAAGCTGAAATGAATCAGG + Intergenic
1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG + Intronic
1164061657 19:21680640-21680662 GATTCTCTGTGAAAGGAAACTGG - Intergenic
925450570 2:3965988-3966010 AATTTACACTGAAGGGAATGTGG + Intergenic
928829315 2:35460158-35460180 AATCTACTCTGAAAGGAAAATGG - Intergenic
929354047 2:40997704-40997726 GATTTAAGCTGAAAGGAAGTAGG - Intergenic
934167509 2:89307650-89307672 CACCTCCTCTGAAAGGAATCTGG - Intergenic
934199766 2:89874796-89874818 CACCTCCTCTGAAAGGAATCTGG + Intergenic
935705100 2:105849741-105849763 GTCTTACTCTGCAAGGAACCTGG + Intronic
938315203 2:130320472-130320494 GATTTACTCTCAAATGTTTCTGG - Intergenic
941078176 2:161030180-161030202 AATTTAGTCTGAATAGAATCTGG + Intergenic
941925484 2:170890015-170890037 TAGTTTCTCTGAAAGGCATCAGG - Intergenic
942155449 2:173122794-173122816 CATTTACTATCAAAGGGATCAGG - Intronic
942403394 2:175627381-175627403 GGTTTGTTCTGAAAGCAATCTGG + Intergenic
943783941 2:191855683-191855705 GATTGACCTTTAAAGGAATCAGG + Intergenic
944260643 2:197672587-197672609 GATCTACTTGGAAAGGTATCTGG - Intronic
944538510 2:200734827-200734849 AATTTACTCTCAAATGATTCAGG - Intergenic
946539570 2:220669318-220669340 GAATTACTCTGGAAGAAATGTGG - Intergenic
947464878 2:230334252-230334274 CATTTCCTCTGCAAGTAATCAGG + Intronic
1169423435 20:5477712-5477734 CATTGACTCTGAAAGGGAACAGG + Intergenic
1170262633 20:14427798-14427820 GAATTAAGCTGCAAGGAATCAGG - Intronic
1170892789 20:20390438-20390460 GCTTTGCTCTGGATGGAATCTGG + Intronic
1171128379 20:22624752-22624774 GACTTAATCTGAAAAGCATCTGG - Intergenic
1173164000 20:40673466-40673488 AATGTACATTGAAAGGAATCTGG - Intergenic
1173345905 20:42199656-42199678 GATTTCCTCTGAAAGGAGAGTGG - Intronic
1180590656 22:16934407-16934429 GATATACTCTGAAAGGGAAGGGG + Intergenic
949437329 3:4043503-4043525 GACTTCCTGTGAAAGGAGTCTGG - Intronic
950607533 3:14096180-14096202 TATTTAATCTGAGAGAAATCTGG - Intergenic
950915782 3:16643938-16643960 GTTTTATTCTGAAAGTCATCAGG - Intronic
955711788 3:61787286-61787308 TAATTACTCTGGAAAGAATCCGG + Intronic
956682576 3:71795066-71795088 GATTTAATCTCATAGGAACCAGG + Intergenic
957771727 3:84702436-84702458 AATTTACTCTGAAAGCCATCTGG + Intergenic
958684985 3:97380603-97380625 CATTTACTCTTAAAGGAAAAAGG + Intronic
961028699 3:123584394-123584416 GCTTTAATCTGAAAGGTATTGGG - Intronic
961107674 3:124256123-124256145 GATTTGCTCAGACAGGAACCTGG + Intronic
962778011 3:138681979-138682001 GATTTACTCTGGAAAGAAGCTGG - Exonic
964577736 3:158193732-158193754 AATTTAATCAGAAAAGAATCAGG + Intronic
965213046 3:165820434-165820456 GAGTTACTCAGAAAAGAATAAGG - Intronic
965239318 3:166174367-166174389 AATTCATTCTCAAAGGAATCTGG + Intergenic
965335456 3:167427261-167427283 GTTTTACTCCCAAAGGAAGCTGG + Intergenic
965338131 3:167453613-167453635 TATTTCCTTTGAAAGAAATCTGG - Intronic
966072454 3:175895473-175895495 GATTAATTCTGGCAGGAATCAGG + Intergenic
966839330 3:184076146-184076168 CATTTTCTCTGAAAGGTACCTGG + Intergenic
967033516 3:185630481-185630503 GACTTCCTCTGAAAGGCAACAGG - Exonic
967440137 3:189498024-189498046 AATTTATTCTGAAACTAATCAGG + Intergenic
968284926 3:197502908-197502930 GATGGACTCTGAAAGGAAAGTGG - Intergenic
968695497 4:2024009-2024031 GATTAATTCTGGGAGGAATCAGG - Intronic
969071175 4:4540866-4540888 GATTTACTGTGAAATTAATGAGG + Intronic
970542251 4:17091971-17091993 GCTCTACTTTGAAAGGAAGCAGG - Intergenic
971062970 4:22993251-22993273 GATCTACTCAGAAAGCAATGTGG - Intergenic
971176278 4:24285381-24285403 GATGTCCTCAGAAAGGAATGAGG + Intergenic
971260906 4:25056191-25056213 CATTTGGTGTGAAAGGAATCTGG + Intergenic
971935237 4:33139022-33139044 GATTTTCTCTGAAAGCTACCTGG + Intergenic
972062762 4:34898717-34898739 GATCTACTTTGAAATGAATATGG - Intergenic
972308809 4:37859519-37859541 GATTCTATCTGAAAGGCATCAGG - Intronic
972428196 4:38954906-38954928 GATTTTCTTTGAATGCAATCTGG + Intergenic
972899149 4:43660600-43660622 GATTTACTCTGTAAGCAAGAAGG + Intergenic
973842237 4:54874013-54874035 AATTTACCCTGAAATCAATCTGG + Intergenic
975208649 4:71673178-71673200 GAATGACTCTGAAAGAAAGCAGG - Intergenic
975808406 4:78137874-78137896 TATTAACTCTTAAAGCAATCTGG - Intronic
977144391 4:93418813-93418835 GTTTTTCTCTGTCAGGAATCTGG + Intronic
983310104 4:166048534-166048556 GATTCCCTCTGAAAGTAATTTGG + Intronic
983351331 4:166594174-166594196 GGTTTCCTATGAAATGAATCAGG - Intergenic
983377302 4:166946288-166946310 CTTTTACTCTGAAAGGAAAGGGG - Intronic
985862649 5:2486191-2486213 GATTTACTCAGAAAACTATCAGG - Intergenic
987163321 5:15168092-15168114 AATTAACTCTCAAAGGAATAAGG - Intergenic
987391818 5:17383659-17383681 GATTAACTCTGAAATGAAAACGG + Intergenic
987429775 5:17818516-17818538 GATTTACTTTGAAGAGCATCTGG - Intergenic
988313889 5:29598656-29598678 GATTTTCTCTGAAAGATATATGG + Intergenic
990890055 5:60638209-60638231 AATTTACACTGAAAGGAACATGG - Intronic
992617758 5:78561749-78561771 CATTTACTCTCAGAGAAATCAGG + Intronic
992721023 5:79561306-79561328 CATTTTCTATGAAAGGAAACTGG + Intergenic
993634137 5:90324219-90324241 TATTTACTTTGAATGCAATCGGG - Intergenic
994900895 5:105767888-105767910 TATTTACTGTGACAGGCATCAGG - Intergenic
995118795 5:108513545-108513567 AAGTTACTCTCAAAGGATTCAGG + Intergenic
995917293 5:117263173-117263195 GAGGTACTCAGAAAGGAATCTGG - Intergenic
996669994 5:126106616-126106638 GTTTTATTCTGAAAGAAATAAGG + Intergenic
997502933 5:134392372-134392394 GATTTTCTCGAAAAGGAATGTGG - Intergenic
999410410 5:151345282-151345304 GAGGTACTCTGAAAGGAGCCCGG + Intronic
1000281348 5:159785007-159785029 GATTTCCCCTGAAGGAAATCAGG - Intergenic
1001179468 5:169505625-169505647 GTTTTACCCTGAAAGCAATAAGG - Intergenic
1005519399 6:26585794-26585816 TATTTACCTAGAAAGGAATCTGG + Intergenic
1007751870 6:44076024-44076046 AATTTACTCTGAAAGCAATGGGG + Intergenic
1008202876 6:48614285-48614307 TATTTACTCTGAATGATATCAGG - Intergenic
1008711291 6:54230298-54230320 GATTTGGTCTGGAAGAAATCGGG - Intronic
1009428998 6:63545700-63545722 GTTTTCCTCTAAAAGGAAACAGG - Intronic
1010084209 6:71897368-71897390 ACTTTACTCTGAAAGCAAGCGGG - Intronic
1011744038 6:90391952-90391974 CATTGCCTCTGATAGGAATCAGG + Intergenic
1012406575 6:98907241-98907263 GATTTATCCTGAAAGCAATGAGG + Intronic
1015111417 6:129596148-129596170 GATTTACTCTGAGTGAAATGGGG - Intronic
1015454881 6:133415316-133415338 CATTTATTCTGAGAGGAATGGGG - Intronic
1015581654 6:134731442-134731464 GAGTTACTCTGAAAGTCATAAGG + Intergenic
1017826573 6:158086249-158086271 GATTTGATCTGTAAGGAAGCAGG + Intronic
1020639461 7:10737478-10737500 GATGTGCTCTCAAAGGAATGCGG + Intergenic
1020875829 7:13692316-13692338 GGTTTACTCTGACATGAATTTGG + Intergenic
1023110956 7:36810051-36810073 GCTTTTCTCTGAAAAGAATAAGG + Intergenic
1026473179 7:70711600-70711622 GATTTGCTCTGACATGAACCAGG - Intronic
1027807127 7:82841956-82841978 GATTCACTCTGGAAGGGAGCAGG - Intronic
1028313605 7:89370771-89370793 AATGTACTTTGAAAGAAATCTGG + Intergenic
1028951950 7:96646057-96646079 GAGGTACTCTCAAAGGAATAGGG - Intronic
1030380400 7:108804205-108804227 GCTTGACTCTAAATGGAATCTGG + Intergenic
1040780689 8:51105341-51105363 GACTTATTCTGGCAGGAATCTGG + Intergenic
1041969426 8:63720441-63720463 GATCTACACTGAAGGGAAACTGG - Intergenic
1046970790 8:120221046-120221068 CATTTACTGTGAAAGGATTTTGG + Intronic
1048264513 8:132973856-132973878 TATTTACTCTGAAACTAATAAGG - Intronic
1051009144 9:12389011-12389033 GAGTTACTCTGGAAGGCAACTGG - Intergenic
1055421580 9:76148888-76148910 GATTTACTCTGGAGGCAATGAGG - Intronic
1056918458 9:90764662-90764684 GATTAATTCTGGCAGGAATCAGG - Intergenic
1059512464 9:114862241-114862263 CATTTACTCAGAAAGTTATCTGG - Intergenic
1059997586 9:119927354-119927376 GATTAACTCTGAAAAGGAGCTGG - Intergenic
1060163204 9:121386257-121386279 GATTTATTCTGAAACAAATAAGG + Intergenic
1060451823 9:123750012-123750034 GGTGTCCTCTGAAAAGAATCAGG + Intronic
1061320578 9:129825856-129825878 ATTTTACAATGAAAGGAATCAGG - Intergenic
1061342084 9:129990616-129990638 GATTTACTCTGAATGAAATGGGG + Intronic
1187023240 X:15406533-15406555 GCTTTTCTCTGAAACCAATCAGG - Intronic
1188643647 X:32537444-32537466 GATATACTCTGAAAGAAAACAGG + Intronic
1189277853 X:39799757-39799779 GATTTATTCTGTAAAGAATGAGG - Intergenic
1189601283 X:42629448-42629470 GTTTGACTCTGAAAGCAATAAGG - Intergenic
1193514271 X:82445026-82445048 CATTAACTCTCAAAGGATTCTGG - Intergenic
1194564197 X:95462714-95462736 TAGTGACTCTGAAAAGAATCAGG + Intergenic
1194964954 X:100277704-100277726 GAAATACTCAGAAAGCAATCTGG + Intergenic
1195447575 X:104971768-104971790 GATTAACTCTGGCAGGAATCAGG - Intronic
1196769530 X:119280141-119280163 CATTTCCACTAAAAGGAATCAGG - Intergenic
1197401537 X:125997826-125997848 GAATTAGTCTGACAGGAATATGG + Intergenic