ID: 1163842240

View in Genome Browser
Species Human (GRCh38)
Location 19:19618560-19618582
Sequence GCAGGACGTCGCTCGTGTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163842231_1163842240 27 Left 1163842231 19:19618510-19618532 CCTGGCCTGTGCCTCGTCCAGGC 0: 1
1: 0
2: 3
3: 39
4: 277
Right 1163842240 19:19618560-19618582 GCAGGACGTCGCTCGTGTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1163842235_1163842240 16 Left 1163842235 19:19618521-19618543 CCTCGTCCAGGCTCTGGTCGGTG 0: 3
1: 1
2: 0
3: 10
4: 113
Right 1163842240 19:19618560-19618582 GCAGGACGTCGCTCGTGTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1163842232_1163842240 22 Left 1163842232 19:19618515-19618537 CCTGTGCCTCGTCCAGGCTCTGG 0: 1
1: 2
2: 4
3: 25
4: 347
Right 1163842240 19:19618560-19618582 GCAGGACGTCGCTCGTGTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1163842237_1163842240 10 Left 1163842237 19:19618527-19618549 CCAGGCTCTGGTCGGTGATGGCC 0: 1
1: 2
2: 1
3: 11
4: 122
Right 1163842240 19:19618560-19618582 GCAGGACGTCGCTCGTGTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163842240 Original CRISPR GCAGGACGTCGCTCGTGTCG AGG Exonic