ID: 1163845211

View in Genome Browser
Species Human (GRCh38)
Location 19:19634760-19634782
Sequence CAGGACACTGAGGGGGACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163845211_1163845220 8 Left 1163845211 19:19634760-19634782 CCCGCGTCCCCCTCAGTGTCCTG 0: 1
1: 0
2: 2
3: 22
4: 250
Right 1163845220 19:19634791-19634813 CCTCCTGAAGAAATCGCTTGAGG 0: 1
1: 0
2: 2
3: 16
4: 215
1163845211_1163845222 28 Left 1163845211 19:19634760-19634782 CCCGCGTCCCCCTCAGTGTCCTG 0: 1
1: 0
2: 2
3: 22
4: 250
Right 1163845222 19:19634811-19634833 AGGACACTCGAGACGTCATGAGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163845211 Original CRISPR CAGGACACTGAGGGGGACGC GGG (reversed) Intronic
900112528 1:1014573-1014595 CAGGGGTCTGAGGCGGACGCTGG - Intergenic
900122227 1:1053687-1053709 CAGGACAGGGTGGGGGAGGCGGG - Intronic
900227102 1:1538422-1538444 CAGCACACTGAGGGCTCCGCGGG - Intronic
901011440 1:6204933-6204955 CAGGACACTCAGGAGAACACGGG + Intronic
901148755 1:7086287-7086309 CAGGGCACTGGGGAGGCCGCCGG + Intronic
901490626 1:9594674-9594696 CAGGGGCCTGAGGGGGAGGCTGG - Intronic
901644622 1:10709836-10709858 CAGGACAATGAGGGGGCCGGCGG + Intronic
902702473 1:18181864-18181886 TAAGACACTGAGAGGGACGGCGG + Intronic
903576382 1:24342092-24342114 CTGGAGACAGAGGGGGCCGCTGG - Intronic
903679418 1:25087357-25087379 CTGGACCCTGAGGGGCAAGCGGG - Intergenic
903742132 1:25564476-25564498 CAGGACACTGAAGGGGCACCTGG - Intronic
903988856 1:27250584-27250606 TGGTACACTGAGGGGGAAGCTGG + Intronic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
904266016 1:29318981-29319003 CAGGACAGTGCGGGGGACAGCGG + Intronic
904331116 1:29758317-29758339 CAGCACAGTGTGGGGGACCCAGG + Intergenic
904481046 1:30793553-30793575 CAGGACCCCGATGGAGACGCTGG + Intergenic
904581488 1:31547346-31547368 AGGGACACTGAGGGAGAAGCAGG + Intergenic
905415898 1:37803991-37804013 CAGGGCACTGAGGAGGAAACAGG + Exonic
907809240 1:57852018-57852040 AAGGAGACTGAGGGGGTCTCAGG + Intronic
911972456 1:104454780-104454802 CAGAACACTGATGGGGTGGCTGG + Intergenic
912519993 1:110238700-110238722 CAGCACGCTGAGGGGGACCAGGG - Intronic
912559188 1:110538083-110538105 CTAGACACTGTGGGAGACGCAGG - Intergenic
912561807 1:110556413-110556435 GAGGACACTGAGGGGCACCAAGG - Intergenic
915065101 1:153218381-153218403 CTGCACACTGAGGTGGACACTGG - Exonic
915284920 1:154846426-154846448 CAGCATACTGAGGGGGAGCCAGG + Intronic
915625748 1:157113134-157113156 CAGGGCACAGAGGGGAACTCTGG + Intergenic
916024715 1:160823659-160823681 CAGGTCACTCAGGAGGGCGCTGG + Exonic
919402107 1:197131649-197131671 CAGGAGAATGAGGGGAACCCGGG - Intronic
920267385 1:204734238-204734260 CAGCAGACTAAGGGGGACGGGGG + Intergenic
920500033 1:206480131-206480153 CTGGGCACAGAGGGGGAGGCGGG + Intronic
922563667 1:226587282-226587304 CAGGAGACTGAGGGGGATGGAGG + Intronic
922796297 1:228341394-228341416 CAGCACAGGGAGGGGGACACGGG - Intronic
923496991 1:234534431-234534453 CAGGACACGGGTGGGGAGGCCGG + Intergenic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
1062916624 10:1245099-1245121 CAGGACACTGGGTGGGAGGCTGG + Intronic
1063617596 10:7614856-7614878 CAGGACCTGGAGGTGGACGCAGG + Intronic
1067016288 10:42758263-42758285 CAGGACAAAGAAGGGGACTCAGG + Intergenic
1069750848 10:70744146-70744168 CAGGACTGTGAAGGGGACGCTGG + Exonic
1070162405 10:73874208-73874230 CAGGGCGCGGAGGGGGATGCGGG + Intronic
1071491063 10:86136737-86136759 CAGGAGATTGAGGGGAACGATGG - Intronic
1072564702 10:96607831-96607853 CAGGACTCAGTGGGGGACGGTGG - Intronic
1073207024 10:101774987-101775009 TGGGGCAGTGAGGGGGACGCAGG - Intronic
1074104511 10:110378338-110378360 CAGCACACAGAGAGGGAAGCAGG - Intergenic
1075719657 10:124577283-124577305 CAGGAGGCTGGGGTGGACGCTGG - Intronic
1077039571 11:513397-513419 CGGGACACTGAGGCGGACGGCGG - Intergenic
1077182581 11:1223299-1223321 CAGGACACTCAGGGAGTCGTAGG - Intronic
1077283551 11:1756172-1756194 CAGGTCAGGGAGGGGGACACAGG - Intronic
1077923205 11:6656172-6656194 CAGGGCACTGAGGGAGAAGAGGG - Intergenic
1081865127 11:46355532-46355554 CAGGAAACTGAGGCTGAGGCAGG + Intronic
1083183512 11:61004011-61004033 TTGGACACTGTGGGGGACACAGG + Intronic
1083309289 11:61776247-61776269 CACGCCACTGAGGGGCACCCAGG - Intronic
1085043728 11:73341806-73341828 CAGGAAACTCAGGGGAAAGCAGG + Intronic
1088357639 11:108960344-108960366 CAGCACACTGGGAGTGACGCTGG - Intergenic
1089390806 11:118100409-118100431 GAGGACACTGAGAGAGACTCTGG + Intronic
1097107812 12:56635548-56635570 GAGGGCACTGAGTGGGACGCAGG - Intronic
1100472410 12:94905301-94905323 CAGGACACTGATGGGAAGGCAGG - Intronic
1102476690 12:113193231-113193253 CAGGAGGCTGAGGGGGAGGATGG - Intergenic
1104322033 12:127761096-127761118 GAAGACACTGTGGGGAACGCTGG + Intergenic
1104869348 12:131983518-131983540 CAGGGCACTGACAGGGAGGCCGG + Intronic
1113780052 13:112971397-112971419 CAGGACACTGATGTGGCGGCTGG + Intronic
1113825319 13:113247995-113248017 CAGGATCCTGATGGGGACACGGG - Intronic
1114416994 14:22551555-22551577 CTGGACACTGAGGAAGACCCAGG - Intergenic
1115028124 14:28766414-28766436 CAGTACAATGAGGAGGAAGCCGG + Intergenic
1118815727 14:69312576-69312598 CAGGACCTTGAGGGTGTCGCTGG + Intronic
1122849031 14:104516714-104516736 CAGGAGGCTGAGGGGGAGGCAGG + Intronic
1123885927 15:24728334-24728356 CAGGACACTAAGGAGAACACAGG + Intergenic
1125386361 15:39141243-39141265 CAGAACACTGAGGGGAAAGATGG + Intergenic
1127992886 15:64133762-64133784 CAGGGCAGTGAGGGAGCCGCTGG + Intronic
1128378262 15:67092630-67092652 CAGGATACTGAGGAGGGTGCTGG + Intronic
1128770029 15:70275153-70275175 CAGGACACTGCTGGGGACCAGGG + Intergenic
1128803210 15:70510323-70510345 CAGGTCACTGAGCAGGACACTGG - Intergenic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1130963492 15:88680719-88680741 CAGGAGACGGAGGGGCAGGCAGG + Intergenic
1131013724 15:89040686-89040708 CGGCACCCTGAGGGAGACGCAGG + Intergenic
1131189265 15:90300994-90301016 CAGGACCCAGTGGGGGAAGCAGG - Intronic
1131388505 15:92028156-92028178 CAGCACACAGTGGGGGAGGCTGG + Intronic
1132148338 15:99441957-99441979 TAGGAGAGTGAGGGGGAAGCAGG - Intergenic
1132462105 16:60577-60599 CAGGGCAATGAGGGGCACGCAGG + Intronic
1132630744 16:916010-916032 CAGGACACAGGGAGGGACACGGG + Intronic
1133015223 16:2936657-2936679 CAGGACTCTGAGGAAGAGGCAGG - Intronic
1133169953 16:3976547-3976569 CTGCATACTGAGGAGGACGCTGG - Intronic
1134116659 16:11553752-11553774 CAGGACAAAGAGAGGAACGCAGG + Intronic
1134134883 16:11671502-11671524 GAGGAAACTGAGGCGCACGCAGG - Intronic
1136692032 16:32039405-32039427 CAGGACACTGGGGGGGGGGGGGG + Intergenic
1136987363 16:35120833-35120855 CCGGACACTGAGGAGGACTATGG + Intergenic
1138434216 16:56988380-56988402 CAGGCCACTGAGGGGCATGGTGG - Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138448109 16:57077475-57077497 CTGGACACTGAGGTTGGCGCAGG - Intronic
1139503939 16:67389745-67389767 GATGACACTGAGGGGGTCACTGG + Intergenic
1141392747 16:83678308-83678330 CAGGACAGTGATGTGGACGGTGG - Exonic
1142365147 16:89646165-89646187 CAGGACACTGAGGAGGAAAAGGG - Intronic
1142611046 17:1109350-1109372 CGGGACACGGAGGAGGGCGCTGG - Intronic
1143104159 17:4520047-4520069 GAAGACACTGAGGGGCAGGCTGG + Intronic
1144478425 17:15609363-15609385 CTGGACACTGGAGGGGAGGCAGG - Intronic
1144777065 17:17790108-17790130 CAGGACACAGAAGGCGAGGCAGG - Intronic
1144919865 17:18754348-18754370 CTGGACACTGGAGGGGAGGCAGG + Intronic
1147649737 17:42055102-42055124 CAGGATGCTGAGGGGGTCGGGGG - Intronic
1149347186 17:55750965-55750987 CAGGAAACTGAGGAGAAGGCGGG - Exonic
1149865036 17:60146858-60146880 CAGGACACTGAGCCTGACGGGGG + Intergenic
1152174944 17:78781691-78781713 CCGGAAACTGCGGGGAACGCGGG + Intronic
1152672995 17:81619981-81620003 CAGGACACAGAGGGTCATGCTGG + Intronic
1152829073 17:82486206-82486228 CAGGACACGGTGGGGGTCTCCGG + Intronic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1153636372 18:7117197-7117219 CCGGACAATGAGGGCGACTCGGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1157369796 18:47100251-47100273 CAGGAGACTGAGGGCTACTCAGG + Exonic
1157424321 18:47571884-47571906 CAGGGGACTCAGGGGGACTCAGG - Intergenic
1157578231 18:48758181-48758203 GAGGACACTGCAGGGGACACCGG + Exonic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157922537 18:51728051-51728073 CAGGACACAGAAGGGCAAGCAGG - Intergenic
1158163043 18:54507635-54507657 CATGGCACTGAGGGGGACGCTGG + Intergenic
1160405555 18:78644109-78644131 CAGGACCCTGTGGAGGAGGCTGG + Intergenic
1160583512 18:79900669-79900691 CAGGAGTCTGTAGGGGACGCAGG + Intergenic
1160859045 19:1230020-1230042 CCGGACGCCGAGCGGGACGCGGG - Exonic
1161247064 19:3258997-3259019 CAGCACCCTGAGGGAGAAGCAGG + Intronic
1161337141 19:3720745-3720767 CAGGCCCCTGAGCGGGAGGCTGG + Intronic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1162108994 19:8390205-8390227 CAGGACACCGAGGGCGAGGAGGG + Exonic
1162311084 19:9907606-9907628 TAGGACCCTGACGGGGACCCTGG - Intronic
1162694483 19:12462199-12462221 CAGGACAATGTGGTGGAAGCAGG + Exonic
1162821428 19:13225700-13225722 CAGGACACTGGAGGGGACACTGG + Intronic
1162931023 19:13957801-13957823 CAGGAGACTGAGGGAGGCGGAGG + Intronic
1163845211 19:19634760-19634782 CAGGACACTGAGGGGGACGCGGG - Intronic
1164399410 19:27892486-27892508 CTGGACACTGAGGGGCAGGGAGG - Intergenic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1166410957 19:42555140-42555162 CAGGACACTGAGGGGACCAAAGG + Intronic
1167361830 19:49034153-49034175 GAGGCCACTGTGGAGGACGCAGG - Intronic
1167619080 19:50551339-50551361 CAGGCCAGTGGGGGGGGCGCGGG - Intronic
1167674896 19:50877889-50877911 CAGGAGACTGTGAGGGAGGCTGG - Intronic
1168628141 19:57935035-57935057 CGGGACACTGAGGCGTTCGCGGG - Intronic
925039194 2:716956-716978 CAGGACACTGAAGTGGCTGCTGG + Intergenic
925901784 2:8514069-8514091 CAGGAGACAGAGGGTGAGGCGGG + Intergenic
925998619 2:9312321-9312343 CAGGTCAATGAGGGGGATTCTGG - Intronic
926108414 2:10166788-10166810 TAGGACACAGGCGGGGACGCAGG - Intronic
926695551 2:15767918-15767940 CAGCACCCTGAGTGGGACGTGGG - Intergenic
931759900 2:65407342-65407364 CAGGAAACTGAGGTGGCTGCAGG + Intronic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
935514920 2:104023960-104023982 CAGCACACTGAGGGTGCTGCTGG + Intergenic
936110352 2:109659716-109659738 ATGGACTCTGAGGGGGCCGCGGG + Intergenic
938185413 2:129227541-129227563 CAGGACCCAGAGTGGGAGGCAGG - Intergenic
938373878 2:130791526-130791548 CAGCACACTGAGAGGGAAGCTGG + Intergenic
940568671 2:155402852-155402874 CAGGACACTGACAGGGACTTAGG + Intergenic
941106652 2:161362168-161362190 CAGGACGCTGAGTGGGAAGATGG - Intronic
942273457 2:174300250-174300272 CAGGACACAGACTGGGACACTGG + Intergenic
942804142 2:179910078-179910100 CAGGACACTCAGGGAGATCCAGG + Intergenic
943657614 2:190526266-190526288 CAGGGCACTGAGGGGACAGCAGG - Intronic
944125747 2:196290791-196290813 CAGAACACTGAGCTGGAAGCAGG - Intronic
945965697 2:216184586-216184608 CAGGAGGCTGAGGCGGAGGCAGG - Intronic
946434772 2:219644236-219644258 CAGCACACTCAGGGGGACCATGG + Intergenic
947330548 2:229025193-229025215 CAGGGTGCTGATGGGGACGCTGG - Exonic
947731903 2:232435912-232435934 CAGGACACAGTGAGGGACGGAGG - Intergenic
948094079 2:235319853-235319875 CTGCACAGTGAGGGGGCCGCTGG + Intergenic
948271062 2:236673653-236673675 TAGAACAATGAGGTGGACGCCGG + Intergenic
948653888 2:239465015-239465037 AAGGACACAGTGGGGGATGCAGG + Intergenic
948867086 2:240781684-240781706 CAGGACACTGCGTGGGACTGCGG - Intronic
1171411268 20:24950215-24950237 CAGGATACTGATGGGGACTTGGG + Intronic
1172587146 20:36092825-36092847 CGGGACGCGGAGGGGGACGGCGG - Intronic
1172619531 20:36309809-36309831 CTGGACACTGAGTGGGCCTCAGG - Intronic
1174017712 20:47502129-47502151 CAAGGCACTGAGGGGCGCGCCGG + Intronic
1174838140 20:53877182-53877204 CAGGACACAGAGGTGGTCTCAGG - Intergenic
1178360529 21:31945578-31945600 CATGTCACTGAGGGTGACACAGG + Intronic
1179542516 21:42092873-42092895 GAGGAAATTGAGGGGGACGAAGG + Intronic
1179655449 21:42841867-42841889 CAGAATACTGAGGGGCACGCTGG - Intergenic
1179810131 21:43865051-43865073 AAGGACGCGGGGGGGGACGCGGG - Intergenic
1179878683 21:44284492-44284514 CAGAACGCTCAGGGGGACCCTGG + Intergenic
1179981263 21:44897120-44897142 CAGGACCCTGCGGGAGACACGGG - Intronic
1179985694 21:44919327-44919349 CAGAATACTGAGGGGCACGCTGG + Intronic
1180160872 21:45998161-45998183 CCGGACACTTACGGGGAAGCCGG - Exonic
1182753185 22:32657964-32657986 CAGGGCACTGAGGGAGATTCAGG - Intronic
1183294075 22:37019609-37019631 CGGGGGTCTGAGGGGGACGCCGG + Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184479151 22:44737011-44737033 CAGGGCCCTGAGTGGGGCGCCGG - Exonic
1184601849 22:45548576-45548598 CAGGACACTGAGGCTGAGGTGGG + Intronic
1184664796 22:45982564-45982586 CAAGACACAGAGGAGGACCCTGG - Intergenic
1185333977 22:50263367-50263389 CTGAACACTGAGGGGTAGGCGGG + Intergenic
1185370412 22:50458386-50458408 CTGGGCACTGAGGGGGACACGGG + Intronic
1185398529 22:50604482-50604504 CAGGACCCCGAGGCGGCCGCGGG + Exonic
1185398691 22:50605129-50605151 CTGGGCACTGTGGGGGACCCTGG - Intronic
950519373 3:13487449-13487471 CAGGGCACTGAAGGAGAAGCAGG + Intronic
950863931 3:16174228-16174250 CTGGCCACCAAGGGGGACGCTGG - Intergenic
950967224 3:17154759-17154781 CAGCACACTGTGGGGGACTGGGG + Intergenic
952815304 3:37442326-37442348 CAGGACTCTGAGAGGGAGGCGGG + Intergenic
953389564 3:42526489-42526511 AAGGACATTGATGGGGAGGCTGG + Intronic
953859400 3:46529976-46529998 CAGGACACAGATTGGGACACTGG + Exonic
953997884 3:47534801-47534823 CAGAACACTGTGGGAGAAGCAGG - Intergenic
954711132 3:52505608-52505630 CAGGACTCAGAGGTGGAGGCTGG + Intronic
955239434 3:57165869-57165891 CAGGAGGGTGAGGGGGACGGGGG - Intronic
956784941 3:72634772-72634794 CAAGACACAGAGAGGGAAGCTGG - Intergenic
961364396 3:126390070-126390092 GAGGGCACCGAGGGGGCCGCGGG + Intergenic
962659748 3:137589488-137589510 CAGGATACTGAGGAGGGTGCTGG - Intergenic
962821101 3:139047735-139047757 CAGGACACTGAGGAGCTCTCAGG - Intronic
964408046 3:156370510-156370532 CAGGACACTAAGAGGGATGAGGG + Intronic
964429916 3:156594571-156594593 CACGACACGGAGGGGAACACAGG - Intergenic
965597378 3:170422063-170422085 CAGGGCACTGTGGGTGAGGCAGG + Intronic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
967017710 3:185496816-185496838 CAGGACACTGACCAGGAAGCTGG + Exonic
968959699 4:3737058-3737080 CAGGAAACAGAGGGAGACGATGG - Intergenic
969209209 4:5673558-5673580 GAGGACTCTGGGGGGGAAGCCGG - Intronic
969238860 4:5887024-5887046 CAGGACAGTGCAGGGGAGGCAGG + Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969579730 4:8057768-8057790 CAGGAGACCGTGGGGGTCGCTGG + Intronic
973278991 4:48340781-48340803 CAGCACACTGGGGCGGAAGCGGG - Intergenic
975343193 4:73264050-73264072 CCGGACACTTAAGGGGACACTGG - Intergenic
976720786 4:88166880-88166902 CAGGTCACTGAGTGGGATACTGG + Intronic
985628737 5:1004174-1004196 CCGGGCACTGAAGGGGACGTGGG + Intergenic
985766959 5:1785164-1785186 CAGGAAACTGAGCGGGAGGAAGG - Intergenic
985957580 5:3276517-3276539 ACGGACACTGAGGCAGACGCAGG - Intergenic
992428657 5:76685690-76685712 CAACACACTGGGGGGGACGGGGG - Intronic
999080789 5:148841808-148841830 CAGCACACTTTGGGGAACGCTGG + Intergenic
1002712461 5:181203737-181203759 CTGCTCACTGAGGGGGAGGCCGG + Intronic
1003731689 6:8831583-8831605 AAGGACCCTAAGGGAGACGCTGG - Intergenic
1004111896 6:12726833-12726855 CAGGACTCTGAGGGGCAGGTGGG - Intronic
1005496984 6:26396296-26396318 GAGGAAACTGAGGGAGAAGCAGG + Intergenic
1006357252 6:33567222-33567244 CAGTAATCTGAGTGGGACGCAGG - Intergenic
1006847156 6:37070578-37070600 CAGAGCACTGAGGGGAAGGCTGG - Intergenic
1010715269 6:79221730-79221752 AAGGACACTGAGGGAGAGGCAGG + Intronic
1012253015 6:97000164-97000186 CAGAAGACTGAGGAGGACTCAGG + Intronic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1017529830 6:155278617-155278639 CAGGACACTGAGGGCGACAGAGG + Intronic
1018611764 6:165654254-165654276 CAGGACAATGAGGAGGATGACGG - Intronic
1018707227 6:166471685-166471707 GAGGACACTGAGGCTGACACAGG + Intronic
1019435877 7:1021899-1021921 CAGGAGCCTGAGGGGCACCCAGG + Intronic
1019488240 7:1299253-1299275 CAGGCCACGGAGGGGGACGCAGG - Intergenic
1021490580 7:21215982-21216004 CAGTACACTGGGGAGGACACTGG + Intergenic
1022093449 7:27123304-27123326 CTGGAAACTGAGAGGGACGCCGG + Intronic
1024046448 7:45588972-45588994 AAGGACACTGCGTGGGACACAGG - Intronic
1024540826 7:50473905-50473927 CAGGCCACTGAGGGAGACAGAGG - Intronic
1024617863 7:51130654-51130676 GAGGACACCCAGGGGGAGGCAGG - Intronic
1026974229 7:74486871-74486893 CAGGACACTGAGGGTGGCGTGGG + Intronic
1029281583 7:99439037-99439059 CAGGAGACCGAGGGGGAGCCGGG + Intronic
1032111787 7:129082166-129082188 TAGGAGGCTGAGGGAGACGCCGG + Intergenic
1032848943 7:135775871-135775893 AAGAACACTGAGGGGGACTGGGG - Intergenic
1033351998 7:140569441-140569463 CAGGACAAGGATGGGGAGGCAGG + Intronic
1035068391 7:156123997-156124019 CAGGACACACAGGCGGAGGCAGG + Intergenic
1036771063 8:11578709-11578731 CAGAACACCGAGGGGGAAGAGGG - Intergenic
1036780394 8:11642869-11642891 GAGGGCACTGAGGGGAAGGCTGG + Intergenic
1038282780 8:26180987-26181009 GAGGACACAGAAGGGGACCCAGG + Intergenic
1038737315 8:30182818-30182840 CAGGAGGCTGAGGTGGAAGCAGG - Intronic
1039782367 8:40797936-40797958 CAGGGCACTGAGGGGCTGGCAGG + Intronic
1041226136 8:55700628-55700650 CAGGACACAGCTGGAGACGCTGG + Intronic
1047520323 8:125591058-125591080 CAGAGCTCTGAGGGGGAAGCTGG + Intergenic
1049168100 8:141139480-141139502 CAGGTCACAGAGGCGGACGCTGG - Intronic
1049316545 8:141972091-141972113 GTGGACACTGAGGGGGAAGCAGG - Intergenic
1049618092 8:143585028-143585050 AGGGACACTGTGGGGGACCCAGG + Intronic
1056572485 9:87828180-87828202 CAGGAGACTGAGGGGTGCTCAGG - Intergenic
1057519880 9:95752151-95752173 CGGGACACTGAGAGGGCAGCGGG - Intergenic
1057982850 9:99679638-99679660 CAGGTCACTGAGGTGGAAACAGG - Intergenic
1059390445 9:113996501-113996523 GAAGTCACAGAGGGGGACGCTGG - Intronic
1059545415 9:115171042-115171064 CAGAAGAGTGAGGGGGACACTGG + Intronic
1059760293 9:117330992-117331014 CAGGACACTGCTGAGGACACAGG - Intronic
1060985160 9:127815529-127815551 CAGGCCTCTGAGAGGGAGGCGGG + Exonic
1061077981 9:128353343-128353365 CTGGACAATGAGGGGGAAGTGGG - Intronic
1061444814 9:130631849-130631871 CAGGGCACTGAGGGGGCAGTCGG - Intronic
1061814795 9:133188249-133188271 CAAGCCCCAGAGGGGGACGCTGG - Intergenic
1062325070 9:136009044-136009066 CAGGACAGGGAGGGAGCCGCTGG - Exonic
1062570266 9:137181725-137181747 CAGGACAGTGAGGATGACTCAGG - Exonic
1062690767 9:137841239-137841261 GAGGATACGGAGGGGGACGGTGG - Intronic
1062690784 9:137841291-137841313 GAGGATACGGAGGGGGACGGTGG - Intronic
1062690809 9:137841368-137841390 GAGGATACGGAGGGGGACGGTGG - Intronic
1062690842 9:137841470-137841492 GAGGATACGGAGGGGGACGGTGG - Intronic
1062690910 9:137841672-137841694 GAGGATACGGAGGGGGACGGTGG - Intronic
1062690961 9:137841824-137841846 GAGGATACGGAGGGGGACGGTGG - Intronic
1062690970 9:137841851-137841873 GAGGATACGGAGGGGGACGGTGG - Intronic
1062690995 9:137841928-137841950 GAGGATACGGAGGGGGACGGTGG - Intronic
1062691012 9:137841980-137842002 GAGGATACGGAGGGGGACGGTGG - Intronic
1062691061 9:137842135-137842157 GAGGATACGGAGGGGGACGGTGG - Intronic
1062691103 9:137842263-137842285 GAGGATACGGAGGGGGACGGTGG - Intronic
1189589108 X:42493189-42493211 CAGGCCACTGAGGGGGGCAGTGG - Intergenic
1194519604 X:94902118-94902140 CAGCAGACTGAGGGGTACTCAGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1200240522 X:154490716-154490738 CTGGACGCTGAGGGGGGGGCGGG - Intergenic
1200292469 X:154886283-154886305 CAGCCCGCCGAGGGGGACGCAGG + Intronic
1200339313 X:155382023-155382045 CAGCCCGCCGAGGGGGACGCAGG + Intergenic
1200347157 X:155458670-155458692 CAGCCCGCCGAGGGGGACGCAGG - Exonic
1202129059 Y:21593838-21593860 CAGGACTGTGAGGTGGTCGCTGG - Intergenic