ID: 1163845850

View in Genome Browser
Species Human (GRCh38)
Location 19:19637743-19637765
Sequence CCCCATGAGGTCCTGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 263}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163845850_1163845865 23 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845865 19:19637789-19637811 GGGCGGGAACTGGCTGTCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 96
1163845850_1163845857 1 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845857 19:19637767-19637789 GGAGCCGAGACAGTGGGTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 175
1163845850_1163845858 2 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845858 19:19637768-19637790 GAGCCGAGACAGTGGGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 185
1163845850_1163845854 -6 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845854 19:19637760-19637782 ATGGGGCGGAGCCGAGACAGTGG 0: 1
1: 0
2: 1
3: 12
4: 179
1163845850_1163845864 22 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845864 19:19637788-19637810 GGGGCGGGAACTGGCTGTCGAGG 0: 1
1: 0
2: 0
3: 7
4: 146
1163845850_1163845866 29 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845866 19:19637795-19637817 GAACTGGCTGTCGAGGGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 141
1163845850_1163845862 7 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845862 19:19637773-19637795 GAGACAGTGGGTCTGGGGGCGGG 0: 1
1: 1
2: 2
3: 61
4: 670
1163845850_1163845855 -5 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845855 19:19637761-19637783 TGGGGCGGAGCCGAGACAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 119
1163845850_1163845859 3 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845859 19:19637769-19637791 AGCCGAGACAGTGGGTCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1163845850_1163845856 0 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845856 19:19637766-19637788 CGGAGCCGAGACAGTGGGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1163845850_1163845863 13 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845863 19:19637779-19637801 GTGGGTCTGGGGGCGGGAACTGG 0: 1
1: 0
2: 1
3: 49
4: 529
1163845850_1163845861 6 Left 1163845850 19:19637743-19637765 CCAGGGGACAGGACCTCATGGGG 0: 1
1: 0
2: 1
3: 20
4: 263
Right 1163845861 19:19637772-19637794 CGAGACAGTGGGTCTGGGGGCGG 0: 1
1: 0
2: 2
3: 33
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163845850 Original CRISPR CCCCATGAGGTCCTGTCCCC TGG (reversed) Intronic
901454230 1:9354066-9354088 CCCCACGAGACCCTGTTCCCGGG - Intronic
901785490 1:11621897-11621919 CTCCTTGAGGCCCTGTGCCCAGG - Intergenic
901830509 1:11889124-11889146 CCCCATGGGGCCCAGTGCCCTGG - Intergenic
904264362 1:29309973-29309995 ACCCATGAGGTCCTGCCACAAGG - Intronic
905091313 1:35433398-35433420 CCCTGTGAGGTCGTGTCCTCTGG - Intergenic
905900145 1:41575994-41576016 CAAGATGAGGACCTGTCCCCAGG - Intronic
905909296 1:41642853-41642875 CCCCTAGGGGTCCTGGCCCCTGG - Intronic
907740045 1:57156557-57156579 CCCCAAGTGGTCCTGACTCCTGG - Intronic
907765798 1:57409159-57409181 CCCCAGGAGGTGCAGCCCCCAGG - Intronic
910203036 1:84719534-84719556 CCCCATCAGTTCCTTTCCTCTGG - Intergenic
911297470 1:96134840-96134862 CCCGATGTGGTGCTGCCCCCGGG + Intergenic
912732818 1:112124898-112124920 CCCCAAAAGCTCCAGTCCCCAGG + Intergenic
916505648 1:165425991-165426013 CACAATGAAATCCTGTCCCCTGG - Intronic
916597295 1:166256925-166256947 ACCCATGAGCACCTGTGCCCTGG - Intergenic
917724447 1:177815619-177815641 ACCCATGAGGTCATATCCCTGGG - Intergenic
919727497 1:200893776-200893798 CCCCATGAGTTCCGCTCCACAGG + Intronic
919805833 1:201380579-201380601 CACTTTGAGGGCCTGTCCCCTGG + Intronic
923143688 1:231183039-231183061 CCCCACGAGCTCCTGCCCCAAGG - Intronic
1062962266 10:1581386-1581408 CCGCCTGAGCTCCTGTCCTCGGG - Intronic
1062996197 10:1869529-1869551 GCCCATGAGATCCTGTGCCGAGG + Intergenic
1064300035 10:14115113-14115135 CCAAATGAGAGCCTGTCCCCTGG + Intronic
1066089646 10:32004887-32004909 AGTCATGAGGTCCAGTCCCCAGG + Intergenic
1067112159 10:43408562-43408584 CCCCAATAGGCCCAGTCCCCAGG + Intronic
1071164258 10:82786274-82786296 CCTCATGAAGCCCTGTCCCTAGG - Intronic
1073980850 10:109151922-109151944 CCAAATAAGGTCCTGTTCCCAGG - Intergenic
1075091822 10:119448087-119448109 CCCCATGAAGCCACGTCCCCTGG - Intronic
1075930187 10:126288919-126288941 CATCATGCGGTCCTGTCCCCAGG - Intronic
1076541739 10:131219345-131219367 CCCCAGGAGGGGCTGACCCCTGG + Intronic
1077347786 11:2072157-2072179 CCCAATGAGGTCATGCCCCAGGG + Intergenic
1077423651 11:2464534-2464556 TCCCATGGGCTCCTGGCCCCTGG + Intronic
1078328429 11:10398827-10398849 CCCCAGGAAGTCCAGTCTCCTGG - Intronic
1081693845 11:45095669-45095691 CCCCAAGAGGACATGTCCCAGGG - Intergenic
1084085641 11:66853889-66853911 CCCCAGGAGGCCCCGTCCCGGGG + Intronic
1084097362 11:66920507-66920529 CCCCGGGAAGGCCTGTCCCCTGG + Intronic
1084205073 11:67586428-67586450 ATCCATGAGGTCCTAGCCCCTGG + Exonic
1085204203 11:74720810-74720832 GCCCATGAGCTCCTGTTTCCTGG - Intronic
1085449094 11:76621369-76621391 CCCTGTGAGCTCCTGTCACCTGG - Intergenic
1085534144 11:77208072-77208094 CCCAATGAGGTCCTAGACCCAGG + Intronic
1088037375 11:105334111-105334133 CCTCATGAGGTCATGTCACCAGG + Intergenic
1088437292 11:109828853-109828875 TCCCATGAGGTTCTATCCCAGGG - Intergenic
1088892969 11:114059330-114059352 CCCCATGCACTCCTGTCCTCTGG + Intergenic
1089783658 11:120892618-120892640 ACCCCTGTGGTCCTGGCCCCTGG + Intronic
1090427149 11:126615919-126615941 CTCCATCCTGTCCTGTCCCCGGG - Intronic
1091563330 12:1630368-1630390 CCCCGAGAGCCCCTGTCCCCAGG - Intronic
1091968920 12:4769780-4769802 ATCCATGAGGTCATGTCCTCAGG - Intronic
1093003797 12:14030274-14030296 TCCCATGATGTCATGTCACCAGG + Intergenic
1093199522 12:16170250-16170272 ACCCATGTGATCTTGTCCCCAGG - Intergenic
1097222183 12:57457407-57457429 TCCCAGTGGGTCCTGTCCCCTGG - Exonic
1097807734 12:63984723-63984745 CCCCACCTGGCCCTGTCCCCAGG - Intronic
1101840756 12:108325922-108325944 CCCCAACATGTCCTGTGCCCTGG - Intronic
1103703348 12:122859091-122859113 CCCCATGAGCTCCAGAGCCCGGG - Exonic
1104083242 12:125451107-125451129 CCACATGAGATCCTGTCCTGGGG + Intronic
1104629812 12:130391003-130391025 TCCCAGCAGGTGCTGTCCCCGGG + Intergenic
1105029489 12:132872915-132872937 CCCCTTGAGGTACTCTGCCCAGG + Intronic
1105264445 13:18803617-18803639 CCCCATGAGGTTCTGCCTCTTGG + Intergenic
1105433527 13:20358408-20358430 CCCTATGAGTCCATGTCCCCTGG - Intergenic
1106541137 13:30691039-30691061 CCCCCGCAGGTCCTGTCCCTGGG + Intergenic
1108975805 13:56442059-56442081 CAACATGATGCCCTGTCCCCTGG - Intergenic
1110604007 13:77410030-77410052 CCTCCTGAGGTCCTGACCTCAGG - Intergenic
1112226859 13:97548075-97548097 GCACTTGAGTTCCTGTCCCCAGG + Intergenic
1112736885 13:102430701-102430723 CCCTAAGAGGGCATGTCCCCAGG - Intergenic
1113377918 13:109782200-109782222 CCCCAGGAGCTCTTGTCTCCCGG + Exonic
1113952115 13:114077729-114077751 CCCGATGATGCCCAGTCCCCTGG + Intronic
1114524152 14:23357644-23357666 CTTCAGGAGGCCCTGTCCCCAGG - Exonic
1114536560 14:23426709-23426731 TCCTAGGAGGTCCTGTTCCCAGG + Intronic
1114692905 14:24601335-24601357 CTCCATGTGGGCCAGTCCCCAGG + Intergenic
1115721291 14:36163557-36163579 GCCCATGTGGTCCTGACCTCTGG - Intergenic
1116273751 14:42805007-42805029 CTGCATGAGGGGCTGTCCCCAGG + Intergenic
1116574217 14:46552375-46552397 CCCCATGGGGTCCTATTCCCTGG + Intergenic
1116856287 14:49955218-49955240 CCCCATGAGGCCATGTGCTCTGG - Intergenic
1118425180 14:65652794-65652816 CCACATGAGGTCCTGTTAACAGG - Intronic
1119566028 14:75630111-75630133 CCCCAGGGGGTCCTATCCTCAGG - Intronic
1120928903 14:89827453-89827475 TCCCTTTAGGTCCTGTCCTCCGG - Intronic
1121106512 14:91283419-91283441 GGCCATGAGGTCCTGGCCCTCGG - Exonic
1121127811 14:91418686-91418708 CGCAAGGAGGTCCTGCCCCCGGG - Intergenic
1125681001 15:41530124-41530146 CCCCAGGAGTTCCAGTCCCTGGG - Intronic
1127787998 15:62373072-62373094 TCCCATGAGGGCCTGTCCCTAGG - Intergenic
1128238009 15:66080557-66080579 CCCCATTTGGTCCTGAACCCTGG + Intronic
1129191684 15:73941334-73941356 CCCCATGAGGCCCAGGCCCCAGG + Intronic
1131268763 15:90934194-90934216 CCCCATCAGTTCCAGTTCCCAGG - Intronic
1132461095 16:55185-55207 TCACATGAGGACCTGCCCCCAGG - Intronic
1132537699 16:491335-491357 CCCCTTGAGGGCCTGCCCCGAGG + Intronic
1132764880 16:1529287-1529309 CCCCACGAGGGCCTGGCCCGTGG - Intronic
1133270664 16:4609591-4609613 CCCCACGGGGTCCTGGCCTCCGG + Exonic
1133318848 16:4900796-4900818 CCCCATGAGGCCTTTCCCCCAGG + Intronic
1133701236 16:8311169-8311191 TCCCATGAACTCCTGTTCCCCGG + Intergenic
1134092589 16:11399490-11399512 CCGCATGCGGTGCTGGCCCCAGG + Exonic
1134102082 16:11459723-11459745 CCCCATGACCCCATGTCCCCAGG - Intronic
1134530074 16:14975746-14975768 CCCCCAGAGGTTCTGACCCCGGG - Intronic
1135174507 16:20216084-20216106 CCCAATCAGATCCTGTCTCCTGG - Intergenic
1136399524 16:30010090-30010112 CCCCTTCAGGTCCTGGTCCCCGG + Exonic
1136500424 16:30667374-30667396 CCCTATGGGGCCCTGCCCCCTGG + Exonic
1137727993 16:50669972-50669994 CCTCATGAGACCCTGTCCCCTGG - Intronic
1138271548 16:55699472-55699494 TCCCATGAGGTTCTGGCCCCAGG - Intronic
1139866273 16:70065208-70065230 CCCCCAGAGGTTCTGACCCCGGG + Intergenic
1141309522 16:82899867-82899889 GCCCATGATTTCCTGGCCCCTGG + Intronic
1141610364 16:85177773-85177795 CGCCATGGGGTTCTGTCCCTTGG + Intronic
1141750072 16:85952431-85952453 CACCCTGATGTCCAGTCCCCAGG - Intergenic
1141910238 16:87053626-87053648 CCCAACAAGGTCCTGTCCCAAGG - Intergenic
1142033787 16:87851639-87851661 GGGCATGAGGTCCCGTCCCCGGG - Intronic
1142854294 17:2721431-2721453 CCCCACGCGCTCCTGGCCCCTGG - Intergenic
1143377840 17:6477946-6477968 CCTCCCGCGGTCCTGTCCCCCGG + Intronic
1144009427 17:11132478-11132500 CCCAAAGAGTTCCTGTTCCCAGG - Intergenic
1144522621 17:15963987-15964009 TCCCAGGAGGCCCTGGCCCCGGG - Intronic
1145306865 17:21680199-21680221 CCCCCAGAAGTCCTGTCCTCAGG + Intergenic
1145307093 17:21681364-21681386 CCCCCAGAAGTCCTGTCCTCAGG + Intergenic
1145307323 17:21682529-21682551 CCCCCAGAAGTCCTGTCCTCAGG + Intergenic
1145307545 17:21683694-21683716 CCCCCAGAAGTCCTGTCCTCAGG + Intergenic
1145307776 17:21684859-21684881 CCCCCAGAAGTCCTGTCCTCAGG + Intergenic
1148125413 17:45234050-45234072 CCCCATTGCATCCTGTCCCCAGG + Exonic
1148331413 17:46815939-46815961 CCGCCTGTGATCCTGTCCCCAGG - Intronic
1148353744 17:46959925-46959947 CTCCATGATGTCCTGTCTCAGGG - Intronic
1149527292 17:57366570-57366592 CCCAGTGAGGTCCTGAGCCCTGG - Intronic
1150602711 17:66664365-66664387 CCCCATCATTTCCTGCCCCCAGG + Intronic
1151405950 17:73886336-73886358 CTCTAAGAGGCCCTGTCCCCGGG + Intergenic
1151504749 17:74520411-74520433 CCCCATGAGGCCCTTCCCACAGG - Intergenic
1151758314 17:76087218-76087240 CCCCCTGAGCTCCAGTCCCAGGG + Intronic
1152384868 17:79966440-79966462 CCCCAGGACCTCCTCTCCCCAGG + Intronic
1152523422 17:80873589-80873611 CCGCCTGGGGCCCTGTCCCCGGG - Intronic
1203170035 17_GL000205v2_random:140386-140408 GCCCATCCGGTCCTGTCCCTGGG - Intergenic
1153673871 18:7438470-7438492 CCACCTGAGTTCCGGTCCCCTGG - Intergenic
1156450984 18:37266430-37266452 CCCCATGCAGTGCTGGCCCCAGG + Intronic
1157105117 18:44766986-44767008 CCCCATGAAGGTCTGTCCCATGG + Intronic
1157603861 18:48913365-48913387 CCCCATGAGGGACTGCCACCAGG - Intergenic
1157693744 18:49704161-49704183 CACCCTGAGGACCTGTCCCCTGG + Intergenic
1160139531 18:76309264-76309286 CCCTATGAGGTACTGTACCCTGG - Intergenic
1160536961 18:79599837-79599859 CCCCAGTGGGTCCTGTCCCTCGG + Intergenic
1160831359 19:1106170-1106192 CCCCAAGCTGTCCTGTCTCCAGG - Intronic
1161295811 19:3519737-3519759 CCCCAGGAGCCCCTGCCCCCAGG + Intronic
1161314207 19:3610344-3610366 CCCCATGAGAGCCTGGGCCCAGG + Intergenic
1161714107 19:5865915-5865937 GCCCTTGAGGCCCTGCCCCCGGG - Exonic
1161723586 19:5916427-5916449 CCCAAAGAGGCCCTGTGCCCAGG + Exonic
1161951983 19:7472636-7472658 CCCCTTCAGGTCCAGTCCCCAGG + Intergenic
1162272493 19:9627914-9627936 CCCCATATAATCCTGTCCCCAGG + Intronic
1162501228 19:11055053-11055075 TCCCTGGAGGTCCTGTCCTCAGG - Intronic
1163171306 19:15533006-15533028 CCCCAGGAGGTCCTGATCCAGGG - Intronic
1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG + Intronic
1163845850 19:19637743-19637765 CCCCATGAGGTCCTGTCCCCTGG - Intronic
1165104549 19:33461393-33461415 GCCCATGCAGCCCTGTCCCCAGG + Intronic
1165255890 19:34577096-34577118 CGCCCTGAGGTCTTGTCCCTGGG + Intergenic
1165524217 19:36339364-36339386 CCCCCAGTGGTCCTGTCTCCAGG + Exonic
1166253496 19:41586651-41586673 CCCCATCCCTTCCTGTCCCCAGG - Intronic
1166591520 19:44003466-44003488 CCCGAAGAGGTCAGGTCCCCGGG + Intronic
1166764608 19:45245368-45245390 CCCGCTGCTGTCCTGTCCCCAGG + Intronic
1166778137 19:45324589-45324611 CCCCATCTGCTCCAGTCCCCTGG - Intergenic
1168063324 19:53906343-53906365 CCCCATCAGGCCCTGAGCCCAGG - Exonic
1168309226 19:55452243-55452265 TCCCAGAAGGTCCGGTCCCCTGG - Intergenic
1168523276 19:57069335-57069357 CCCCTTGAGGTCCAGTCCCGCGG + Intergenic
925003122 2:421953-421975 CTCCATGGGGTCCTGTCCTATGG + Intergenic
925391310 2:3496129-3496151 CCCAATGAAGTCCTGGCCCCAGG - Intergenic
925587274 2:5476052-5476074 CCACATGAGGTCATATTCCCAGG - Intergenic
925615779 2:5743477-5743499 CACCAAGAGGTCCTGGCACCAGG - Intergenic
926308915 2:11660321-11660343 CCTCATGTGATCCTGTCCTCTGG + Intronic
929870429 2:45754634-45754656 CCCCTTGAGGGCCTGCCCCTGGG + Intronic
930028728 2:47045434-47045456 CCCGCTGAGGTCCTGCCTCCAGG + Intronic
931456726 2:62415365-62415387 TCCCAGGAGGGCCTCTCCCCAGG - Intergenic
937125608 2:119473402-119473424 CCCTATAGGTTCCTGTCCCCGGG + Intronic
944908360 2:204285201-204285223 CCGCAGGGGGACCTGTCCCCAGG + Intergenic
947527243 2:230886205-230886227 CCCCATGAGGGCACGTCCCATGG - Intergenic
947707024 2:232284646-232284668 CCCCATGTGGTCTTTGCCCCGGG + Intronic
947730988 2:232431562-232431584 CTCCATGGGGCCCTGTTCCCAGG - Intergenic
947856748 2:233329239-233329261 CCCCATAACCTCCTGACCCCTGG + Intronic
948164376 2:235850072-235850094 CCCCACGGTGTCCTGGCCCCAGG + Intronic
948675452 2:239594089-239594111 CCCCAGGCAGTCCTCTCCCCAGG - Intergenic
1168892045 20:1300943-1300965 TCCCATGAGGGCCTGTCCTGTGG + Intronic
1169337315 20:4766934-4766956 CTCCTTGAGGACCTGTCTCCGGG - Intergenic
1171531427 20:25856027-25856049 CCCCCAGAAGTCCTGTCCTCAGG + Intronic
1171533276 20:25866023-25866045 CCCCCAGGTGTCCTGTCCCCAGG + Intronic
1172382463 20:34506729-34506751 CCCCATGACTCCCTTTCCCCAGG + Intronic
1174395993 20:50247202-50247224 CCCCAGGCTGTCCTGACCCCTGG - Intergenic
1174581475 20:51575005-51575027 CCCCATGTGGGCCTCTCCTCAGG + Intergenic
1175011548 20:55742780-55742802 CTCCATGAGGTACTTTTCCCAGG + Intergenic
1175170221 20:57074932-57074954 CCAAATAAGGTCCCGTCCCCAGG - Intergenic
1175825070 20:61932224-61932246 CCCCATGTCCTCCCGTCCCCAGG + Intronic
1175826196 20:61937840-61937862 CCCCATGGGGTCTGGTCGCCAGG - Exonic
1176181440 20:63751662-63751684 CCCCATGAAGCCCCGCCCCCCGG + Intronic
1176181506 20:63751810-63751832 CCCCATGAAGCCCCGCCCCCCGG + Intronic
1176326030 21:5502181-5502203 GCCCATCCGGTCCTGTCCCTGGG - Intergenic
1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG + Intergenic
1176435430 21:6670334-6670356 GCCCATCCGGTCCTGTCCCTGGG - Intergenic
1176459692 21:6997404-6997426 GCCCATCCGGTCCTGTCCCTGGG - Intergenic
1176483253 21:7379182-7379204 GCCCATCCGGTCCTGTCCCTGGG - Intergenic
1176684779 21:9838225-9838247 CCCCCAGAGCTCCTGTCCTCAGG + Intergenic
1176849522 21:13902059-13902081 CCCCATGAGGTTCTGCCTCTTGG + Intergenic
1181427314 22:22852057-22852079 CCCCATGTGCTCTTGTTCCCTGG - Intronic
1183520815 22:38295176-38295198 CCCCTTGAGCTTCTGTCCCAAGG - Intronic
1183946964 22:41332034-41332056 CCCCGAGAGTCCCTGTCCCCAGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184532092 22:45062432-45062454 CCCCTTGAGGTCCCGGCCCATGG - Intergenic
1184765576 22:46570369-46570391 CCCCAAGCAGTCCTGGCCCCTGG + Intergenic
1185159788 22:49216606-49216628 TCCCATGACCTCCTCTCCCCTGG + Intergenic
1185299599 22:50072498-50072520 GCCCATCAGGTGCTGCCCCCTGG - Intronic
1185331159 22:50252602-50252624 CCCCATCAGGCCCTGCCCCTGGG + Intronic
952792536 3:37211684-37211706 CCCCATGAGGACCTCTCCATAGG + Intergenic
954124235 3:48519271-48519293 CCCCATGAAGACCTGGCCTCTGG + Exonic
954223371 3:49167742-49167764 CCCCATGAGATCCTGGCCCCTGG - Intergenic
954631330 3:52049336-52049358 CCCCATGCAGTCCTGACACCTGG + Exonic
955621236 3:60866436-60866458 CCCCATGTGGGCCTCTCCACTGG - Intronic
961372058 3:126437257-126437279 CACTCTGAGGTGCTGTCCCCAGG - Intergenic
962197419 3:133376320-133376342 CCACCTGAGGGCCTGTCCCTGGG + Intronic
967527122 3:190507903-190507925 CAGCATGAGGTCATGTCCCTAGG + Intergenic
967877696 3:194277954-194277976 CCCCATGAGGCCTTGACCTCAGG + Intergenic
967886456 3:194336836-194336858 CCCCAGGAGCTCCTGGCCACCGG + Intergenic
968228524 3:196990786-196990808 CCCCGTGAGCTCCAGTGCCCAGG - Intronic
968927174 4:3555672-3555694 CACCTTGAGGTCCTGTGCCTGGG + Intergenic
969296393 4:6272554-6272576 GCCCAGGAGGTCCTGGCCCTGGG - Intronic
969883960 4:10198658-10198680 CTCCATTAGGTCCTGTGTCCAGG + Intergenic
977571653 4:98635264-98635286 CCCCTTAAGGTCCTATCCCATGG + Intronic
979455547 4:120922543-120922565 CCCCATGCCGTCCTGAACCCGGG + Exonic
982261150 4:153495383-153495405 CCTCAGGAGGTCCTGTGCCCAGG + Intronic
982829544 4:160043161-160043183 CTCCATGAGGGCCTTACCCCTGG + Intergenic
985125341 4:186688423-186688445 CCCCATGTGGTCCTTTCACAGGG + Intronic
994037750 5:95222122-95222144 CCCCATGAGGTCAGGCACCCAGG + Intronic
997435358 5:133870242-133870264 CCCCATGAGTTCATGACCCAGGG + Intergenic
998096049 5:139395968-139395990 CCCCACCAGCGCCTGTCCCCAGG - Intergenic
1002099538 5:176850577-176850599 CCCCATCAGCTCCTGCCCCGGGG - Intronic
1002526233 5:179817379-179817401 CCCCAAGTGGCCATGTCCCCCGG + Intronic
1002585900 5:180247863-180247885 CTCCATAAAGTCCTGTTCCCGGG - Intronic
1007428729 6:41764079-41764101 CCCAGTGAGCTCCTGTCCCTGGG - Intergenic
1007464013 6:42039393-42039415 ACCCATGTAGTCCTGTCCTCTGG + Intronic
1009485590 6:64218127-64218149 CAGCATGAGGCCCTGTCCCTAGG + Intronic
1013169997 6:107628351-107628373 CCCTAGGAGGCTCTGTCCCCAGG - Intronic
1016847986 6:148587816-148587838 CCACAGGAGGCCCTGTCCCAGGG + Intergenic
1018858256 6:167690883-167690905 CCTCAGGAGGTCCTGACCACAGG - Intergenic
1019067719 6:169316426-169316448 CACCATGAGTCCCTGTCTCCTGG - Intergenic
1019074968 6:169379661-169379683 CTCCCCGAGGTCCTGTCCCCGGG - Intergenic
1019127856 6:169852776-169852798 CCCCATGGGGTCCTCCTCCCTGG - Intergenic
1019774416 7:2903975-2903997 CCTCATGTGGACCCGTCCCCGGG + Intergenic
1021992940 7:26154176-26154198 CCCCATTGGTTCCGGTCCCCAGG - Intronic
1023606157 7:41933082-41933104 CCCCTTGTGTTCCTGTCCCTGGG + Intergenic
1023889640 7:44383027-44383049 CACCCCTAGGTCCTGTCCCCAGG + Exonic
1025204034 7:56981297-56981319 CGGCAGGAGGTCCTGTCCACAGG - Intergenic
1025248762 7:57337782-57337804 CTCCATTGGGTCCTCTCCCCTGG + Intergenic
1025667906 7:63595637-63595659 CGGCAGGAGGTCCTGTCCACAGG + Intergenic
1025888365 7:65621139-65621161 GACCATGACGGCCTGTCCCCAGG - Intergenic
1026513865 7:71049829-71049851 CCCCATGGGATCCAGTCTCCAGG + Intergenic
1031078947 7:117240055-117240077 GCCCGTGAGGTCCTGGGCCCTGG + Intergenic
1031854071 7:126900828-126900850 GACCATGATGGCCTGTCCCCAGG + Intronic
1034442944 7:151096317-151096339 CCCCCTCAGGTCCCTTCCCCTGG - Intronic
1035308958 7:157952755-157952777 CCCCTGGGGTTCCTGTCCCCTGG - Intronic
1036223895 8:6942585-6942607 GCCCCTGATGTCCTGTCCCCAGG - Intergenic
1036427233 8:8655777-8655799 CAGCATGAGGTCCTGGACCCTGG + Intergenic
1037891200 8:22624573-22624595 ACAGATGAGGCCCTGTCCCCTGG + Intronic
1041148391 8:54904453-54904475 TGCCATGAGGGCCTGTCCCAAGG + Intergenic
1041731798 8:61070153-61070175 GCCCCTGAGGCCCTGTCCTCAGG + Intronic
1042532236 8:69828020-69828042 CCCCATGACTTTCTGACCCCAGG - Intronic
1047199867 8:122755979-122756001 CCCCATAAAGTCCTGCTCCCAGG - Intergenic
1048871757 8:138804669-138804691 CCCCCTCAGCTCCTCTCCCCTGG - Intronic
1048901292 8:139040144-139040166 CCCCATGATATGCTCTCCCCAGG - Intergenic
1049398759 8:142415401-142415423 CCCCATTAGCCCCTGTCCACCGG - Intergenic
1049618673 8:143588132-143588154 CCCTATGGGGTCCTGCCCTCAGG + Intronic
1049624506 8:143613981-143614003 CCCCATAGGCTCCTGTCTCCAGG - Intronic
1050164386 9:2748601-2748623 CCCCATTAGGTCCCATCCCTGGG - Intronic
1051517906 9:17951177-17951199 CTCCATGATGCCCTGTGCCCCGG - Intergenic
1052336345 9:27324223-27324245 CCCCAAGTGCTCCTGTCCCAAGG + Intergenic
1052840730 9:33289438-33289460 CCCCAGGAGGTGGTGCCCCCTGG + Intergenic
1053135149 9:35646303-35646325 CCCCCTGAGGGTCTGTCCCTGGG + Intronic
1054160671 9:61670418-61670440 CCCCCAGGGGTCCTGTCCTCAGG + Intergenic
1054160960 9:61671827-61671849 CCCCCAGGGGTCCTGTCCTCAGG + Intergenic
1054172785 9:61856362-61856384 CCCCCAGGGGTCCTGTCCTCAGG - Intergenic
1054173074 9:61857733-61857755 CCCCCAGGGGTCCTGTCCTCAGG - Intergenic
1054447633 9:65385365-65385387 CCCCCAGGGGTCCTGTCCTCAGG - Intergenic
1054447925 9:65386775-65386797 CCCCCAGGGGTCCTGTCCTCAGG - Intergenic
1054462880 9:65475088-65475110 CACCTTGAGGTCCTGTGCCTGGG - Intergenic
1054664468 9:67723048-67723070 CCCCCAGGGGTCCTGTCCTCAGG + Intergenic
1054664755 9:67724439-67724461 CCCCCAGGGGTCCTGTCCTCAGG + Intergenic
1057215882 9:93228602-93228624 CCACCTGAGGTCCTGCCCCCAGG - Intronic
1057317539 9:93979444-93979466 CCCCATTAGGTGCAGTCCCTTGG + Intergenic
1060589500 9:124808010-124808032 CCCCATGAGGACCCCTCCCCAGG - Intronic
1060683372 9:125585602-125585624 CCCGATCAGGTCCTGCACCCTGG + Exonic
1061238845 9:129357699-129357721 CCCCAGGAGGCCATGTCCCCAGG + Intergenic
1061456657 9:130703173-130703195 CCACATCAGGTACTCTCCCCAGG + Exonic
1061613333 9:131762926-131762948 CCCCCTGGGGTCCTATCCCGAGG + Intergenic
1061637800 9:131925757-131925779 CCGCAGGAGCTGCTGTCCCCTGG - Intronic
1061859382 9:133460271-133460293 CCCCAGCGGGTCCTTTCCCCTGG - Intronic
1061895441 9:133644497-133644519 CCCCTCGAGGTCCTGTCCCTGGG - Intronic
1062252765 9:135606545-135606567 CCCCGTGAGCTCCTGGCCCATGG - Intergenic
1062379798 9:136281728-136281750 CTCAATGAGGGGCTGTCCCCCGG - Intronic
1062423228 9:136494045-136494067 CTCCCTGAGGGGCTGTCCCCAGG + Intergenic
1062445678 9:136593178-136593200 CCCCATGAGCTGCGGTCCCAGGG + Intergenic
1062637802 9:137500661-137500683 CGCCCTGAGGTCCTGGCCCGTGG + Intronic
1203436099 Un_GL000195v1:138306-138328 GCCCATCCGGTCCTGTCCCTGGG + Intergenic
1185881818 X:3747991-3748013 CCCCCAGAGCTACTGTCCCCAGG - Intergenic
1190131298 X:47751294-47751316 CCTCATGAGGTCCTTTCACTGGG - Intergenic
1190497705 X:51042343-51042365 CCCCATGAGGCCCTTTCTCTTGG + Intergenic