ID: 1163846005

View in Genome Browser
Species Human (GRCh38)
Location 19:19638320-19638342
Sequence CATCATCCCCCAGAATGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163846005_1163846008 -5 Left 1163846005 19:19638320-19638342 CCGCCTCATTCTGGGGGATGATG 0: 1
1: 0
2: 3
3: 9
4: 166
Right 1163846008 19:19638338-19638360 TGATGAGAAGGTCAGCGTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163846005 Original CRISPR CATCATCCCCCAGAATGAGG CGG (reversed) Exonic
900383857 1:2400200-2400222 CAGGTTCCCCCAGAACGAGGAGG - Intronic
901596890 1:10392369-10392391 CCTCAGCCCCCAAAATGAGTGGG - Intergenic
902734836 1:18393416-18393438 AATCAGTCCCCAGAATGAGAAGG - Intergenic
903049958 1:20593322-20593344 CATTGTCCCCCATCATGAGGTGG - Intronic
904259254 1:29279103-29279125 TCTCATCACCCAGTATGAGGTGG + Exonic
904821902 1:33250958-33250980 CCTCCTCCTACAGAATGAGGAGG + Intergenic
905245524 1:36610589-36610611 CATCATCAGCCCCAATGAGGAGG - Intergenic
906529194 1:46513457-46513479 CCTCATTCCCAAGATTGAGGAGG + Exonic
907819650 1:57954413-57954435 CATCATCACCCAAAAGGAGTGGG - Intronic
907841154 1:58158708-58158730 GATCATACCCCGGAAGGAGGAGG + Intronic
912689231 1:111791898-111791920 CATCATCCACCAGTATAAAGAGG + Intronic
915226746 1:154417311-154417333 CCTCATCCACCAAAATGAGCAGG + Intronic
916596971 1:166253167-166253189 CATCATGCCACAGAAAAAGGTGG - Intergenic
919689067 1:200512455-200512477 CATCAACCCACAGAATGAAGGGG + Intergenic
920434938 1:205941561-205941583 CATCCTCCCCTACACTGAGGAGG - Intronic
921384855 1:214558193-214558215 CTGCCTCCCCTAGAATGAGGGGG + Intergenic
923056484 1:230429939-230429961 CTTCATCACCCAAAAGGAGGGGG + Intergenic
1064215903 10:13400470-13400492 CCTCATCCCCTAGCATGAGATGG - Intergenic
1064531841 10:16318257-16318279 CATCATCACCCAGAGTATGGTGG - Intergenic
1065319843 10:24499137-24499159 CATCATTCCCCAGACAGAGAGGG - Intronic
1065588147 10:27240511-27240533 CAACATGCCCCAAAAGGAGGAGG + Intronic
1067784812 10:49237697-49237719 CATCTTCCTCCAGAATGACTTGG - Intergenic
1071691702 10:87826958-87826980 CATCTTCCTGTAGAATGAGGAGG - Intronic
1071710568 10:88045189-88045211 CAAACTCCCCCAGAATGAGTTGG + Intergenic
1075903560 10:126062433-126062455 CATCATCCCCATGATGGAGGGGG - Intronic
1077757156 11:5044574-5044596 CAACATCCCACAGAATTTGGTGG + Intergenic
1079073132 11:17365640-17365662 TTCCATCCCCCAGAAAGAGGAGG + Intronic
1082170042 11:48992799-48992821 CATCATCCCTCAGTGTGAGTGGG + Intergenic
1082607838 11:55263952-55263974 CATCATCCCTCAGTTTGAGTGGG - Intronic
1082867722 11:57914861-57914883 CACCATCCCTCAGAATGTGATGG - Intergenic
1085159062 11:74324338-74324360 CAGCATCCCCCATCAAGAGGTGG + Intergenic
1085253450 11:75158945-75158967 CCTCATCACCCAGACTCAGGTGG + Intronic
1087788741 11:102384823-102384845 CATCAACCAGCGGAATGAGGTGG - Intergenic
1089192042 11:116660366-116660388 CATCATCTCCCAGGAGGAGGAGG - Intergenic
1089560738 11:119341880-119341902 CATGATCACCCAGGAGGAGGTGG - Exonic
1090248866 11:125237101-125237123 CATCAAAGCCCAGAATGATGAGG - Intronic
1090668015 11:128927736-128927758 CAGCATCCCCCAGAATCACAGGG - Intergenic
1091025687 11:132138955-132138977 AATCATCACCGAAAATGAGGTGG + Intronic
1097007982 12:55932353-55932375 CACCATCCCTCCGAATGAGCGGG - Intronic
1097153425 12:56995755-56995777 CATCATCCCGCTGCCTGAGGTGG + Exonic
1097195005 12:57238326-57238348 CATTATCCGCCGGAGTGAGGCGG - Intronic
1099622575 12:85023325-85023347 CATCATCACAAAGAAAGAGGAGG - Exonic
1100882538 12:99034950-99034972 CCTCATCGCCCAAACTGAGGTGG - Intronic
1103217372 12:119212305-119212327 CATCAGTCCCCTGAATCAGGGGG - Intronic
1103592581 12:122002823-122002845 CACCATCACCAAGACTGAGGAGG + Intronic
1103873427 12:124107587-124107609 CAGAAGCCCCCAGAAGGAGGTGG - Intronic
1113250805 13:108450445-108450467 CATCAGCTCCCAGAATGAAGAGG + Intergenic
1117332829 14:54730488-54730510 CTTCTTCCCCCGGAATGAGGTGG + Intronic
1118808119 14:69255302-69255324 CTTCCTGCCCCAGGATGAGGGGG - Intergenic
1119483895 14:74976039-74976061 CATCATCCCCTAGGCTGAGCCGG + Intergenic
1121475665 14:94199731-94199753 CATCAACCCCCGGAATGAGGTGG - Intronic
1123925357 15:25104283-25104305 TCTCTTCCCACAGAATGAGGTGG + Intergenic
1127621607 15:60739635-60739657 CACCTTCCCCCAGACTGAGTTGG - Intronic
1128556154 15:68633184-68633206 CATGACCACCTAGAATGAGGCGG + Intronic
1129616006 15:77099063-77099085 CATCATTCCCCAGAAGCATGGGG - Intergenic
1130160845 15:81398424-81398446 CATCCTTCCCAACAATGAGGAGG + Intergenic
1131923460 15:97355268-97355290 CATCATCCTCCAAAAGAAGGTGG - Intergenic
1133413638 16:5589100-5589122 CAACATCTCCCATAAGGAGGCGG - Intergenic
1136319043 16:29470685-29470707 GATGATTCCGCAGAATGAGGAGG - Intergenic
1136433614 16:30210029-30210051 GATGATTCCGCAGAATGAGGAGG - Intergenic
1136542291 16:30934761-30934783 CATCATTCCCCAGGCTCAGGAGG + Intronic
1136684654 16:31986979-31987001 CATCAACCAGCAGGATGAGGTGG + Intergenic
1136785278 16:32930515-32930537 CATCAACCAGCAGGATGAGGTGG + Intergenic
1136884504 16:33923289-33923311 CATCAACCAGCAGGATGAGGTGG - Intergenic
1137754390 16:50889837-50889859 CGGCAGCCTCCAGAATGAGGTGG - Intergenic
1138316022 16:56071050-56071072 CATCATCCCCTTGTATTAGGTGG - Intergenic
1140685700 16:77432544-77432566 CATCATCCCACAAAATGATTTGG + Intronic
1203087935 16_KI270728v1_random:1194524-1194546 CATCAACCAGCAGGATGAGGTGG + Intergenic
1142511731 17:400191-400213 CATAATCCCCAAGAGTTAGGAGG + Intergenic
1142956043 17:3523006-3523028 CATCTCCCCCAAGAATAAGGGGG + Intronic
1147043985 17:37739566-37739588 CAACATCCCCCAGAGGGAGGTGG - Exonic
1147145589 17:38482660-38482682 CATCAACCTGCAGGATGAGGTGG + Exonic
1147156112 17:38545222-38545244 CTTCATGCCCCGGAAGGAGGGGG - Intronic
1147496925 17:40925481-40925503 GATCATCTCCCACTATGAGGAGG - Exonic
1147968579 17:44207358-44207380 TCTCACCCCCCAGAATGAAGAGG - Exonic
1148063858 17:44854570-44854592 TATCATCCACCAGAATGTTGGGG + Exonic
1148978516 17:51550426-51550448 CATCATCCAGCAGGATGTGGTGG - Intergenic
1149052162 17:52318636-52318658 CATGAAGCCCCAGAATGATGTGG + Intergenic
1149869722 17:60170638-60170660 CATCATCTTCCAGGAAGAGGAGG + Intronic
1150483436 17:65528094-65528116 GATCAGCTCCCAGAATGGGGAGG + Intergenic
1153913074 18:9721014-9721036 CACCATTCCCCAAAAGGAGGTGG - Intronic
1156313371 18:35945552-35945574 CATCATCGCCCAACATGGGGTGG - Intergenic
1160715310 19:573616-573638 ATTCAGCACCCAGAATGAGGTGG + Intronic
1163499241 19:17665870-17665892 CAACAGCCCTCAGAGTGAGGGGG + Intronic
1163846005 19:19638320-19638342 CATCATCCCCCAGAATGAGGCGG - Exonic
1164210445 19:23093531-23093553 CCCCACCCCCAAGAATGAGGGGG - Intronic
1164814408 19:31183773-31183795 CTTCATCCCCCAAAAGGAAGAGG + Intergenic
1165175789 19:33928952-33928974 CAGGATTCCCCACAATGAGGGGG - Intergenic
1165413350 19:35675959-35675981 CTTCATCCCCCTCAACGAGGAGG + Exonic
925332787 2:3071721-3071743 CATCATGCACCAGAATTAAGAGG + Intergenic
925417090 2:3677930-3677952 CTTCATCTTCCAGAATGAGGAGG - Intronic
925927764 2:8682318-8682340 CAGCATCCCCCAGAACAAGAAGG + Exonic
926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG + Intronic
926888693 2:17620455-17620477 GATCTTCCCTGAGAATGAGGAGG - Intronic
928451998 2:31385845-31385867 CATCCTCCCCCAGAAAAAGTGGG + Intronic
931263223 2:60638285-60638307 TTTCATCCCCCAGGCTGAGGGGG + Intergenic
934845277 2:97658277-97658299 CATCAACCCACAGAAGGATGAGG - Exonic
935368058 2:102315325-102315347 CATAATGCCCCAGAGTGAAGAGG - Intronic
936461989 2:112721060-112721082 CATCGTCACCCAGAGTGAGGAGG - Intergenic
936874504 2:117172281-117172303 CTTCAGACCCCAGAATGAAGTGG + Intergenic
937259104 2:120574103-120574125 CATCATCCCCCAGAAAGCCCAGG - Intergenic
938095874 2:128463019-128463041 CATGATCCCACAGACTGGGGTGG + Intergenic
941421190 2:165284511-165284533 CATCTTCCCCATGAATGAGCAGG - Intronic
946070565 2:217031012-217031034 CATCTTCTCCTAGAATGAGAAGG + Intergenic
947950810 2:234145567-234145589 CAGCCTCCCCCAGAATTTGGAGG - Intergenic
1170937643 20:20823843-20823865 CATGACCACCCTGAATGAGGCGG + Intergenic
1171726022 20:28621566-28621588 AATCATCCCCACGAATAAGGGGG + Intergenic
1171752107 20:29061810-29061832 AATCATCCCCACGAATAAGGGGG - Intergenic
1171790222 20:29516052-29516074 AATCATCCCCACGAATAAGGGGG + Intergenic
1173637501 20:44573511-44573533 CATCAACCCCAAGAAACAGGAGG - Intronic
1175133386 20:56806125-56806147 CAGCCTCCCCCAGGGTGAGGTGG + Intergenic
1175760156 20:61556920-61556942 CATCAGGCCCCAAACTGAGGCGG - Intronic
1180390928 22:12281173-12281195 AATCATCCCCACGAATAAGGGGG + Intergenic
1180408814 22:12583584-12583606 AATCATCCCCACGAATAAGGGGG - Intergenic
1180938871 22:19643909-19643931 CATCAGCCCCCAGGGTGGGGCGG + Intergenic
1182429627 22:30292089-30292111 GAGCATCCCCCAGGAGGAGGGGG + Exonic
1182529684 22:30945586-30945608 CCTGATCTCCCACAATGAGGGGG + Intronic
1182656809 22:31897171-31897193 CAACATCCCCTAGAATGGGAAGG + Intronic
1184234239 22:43174542-43174564 CACCCTCACCCAGAGTGAGGCGG - Exonic
954004841 3:47582589-47582611 CACCATCCCCCAGAAAGGGAAGG + Intergenic
954680729 3:52344607-52344629 CACCCTCCCCAAGAAGGAGGAGG + Exonic
957816239 3:85301189-85301211 CATCAGCTCCCAGTCTGAGGAGG - Intronic
958485093 3:94695168-94695190 AGTCATCCCCCAGGATCAGGAGG - Intergenic
963269597 3:143272724-143272746 CATCAGCTTCCAGAATGGGGAGG + Intronic
966552009 3:181215728-181215750 CATCATTCCTCATTATGAGGAGG - Intergenic
969332966 4:6490634-6490656 CCACATCCCCTAGAGTGAGGTGG + Intronic
971831492 4:31701541-31701563 CATCAACCAGCAGAATGACGTGG + Intergenic
977764745 4:100783796-100783818 AATCATCTCCCAGGCTGAGGTGG - Intronic
979358026 4:119728943-119728965 CAGCATCCCCCACAATTTGGAGG + Intergenic
979832260 4:125316936-125316958 CATCATCCGCGGCAATGAGGCGG + Exonic
982371403 4:154637436-154637458 AATCATCCCCCAAAATGCTGGGG - Intronic
982910133 4:161130609-161130631 GATCATTCACCAGATTGAGGAGG + Intergenic
983036645 4:162875057-162875079 CATTTTCCTCCTGAATGAGGGGG + Intergenic
985820227 5:2154814-2154836 CATCAACCCCCTGTGTGAGGAGG - Intergenic
986170922 5:5313920-5313942 CATCATCTCCCAAAATTATGTGG + Intronic
986509547 5:8489913-8489935 CATCCTCCCCCAAAATTTGGAGG + Intergenic
987942312 5:24555526-24555548 CATCACCCCCATGAACGAGGGGG - Intronic
988566509 5:32323552-32323574 CATCAACCAGCAGAATGAGGCGG + Intergenic
988598005 5:32612841-32612863 CCACATCTCCCAGAATCAGGAGG - Intergenic
998144236 5:139717158-139717180 CACCATCCCCCTGAATGCTGTGG - Intergenic
1000733289 5:164864216-164864238 GATTATCCCCCATAATGTGGTGG + Intergenic
1001052392 5:168423755-168423777 CACCATCCACGAGGATGAGGTGG + Exonic
1001085469 5:168697180-168697202 CTTCATCCCCCAGAAGCTGGAGG - Intronic
1004884337 6:20037141-20037163 CATGAACCCCCAGAGTCAGGAGG - Intergenic
1016710313 6:147164019-147164041 CATCATCCCCCTGGCTCAGGTGG - Intergenic
1017224555 6:152005798-152005820 CATCTCCCAACAGAATGAGGAGG - Intronic
1018938052 6:168286980-168287002 CTTCAACCCTCAGAATGTGGGGG + Intergenic
1019660177 7:2219726-2219748 CTGCATCCTCCAGAAGGAGGTGG - Intronic
1021175350 7:17443559-17443581 CATCATACCCCAGAGTAAGATGG + Intergenic
1022578936 7:31528425-31528447 CAGCATCCACCAGGATGTGGTGG - Intronic
1022630681 7:32081661-32081683 CATCATCTCAAACAATGAGGTGG + Intronic
1023375590 7:39552210-39552232 CTCCACTCCCCAGAATGAGGTGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1030777479 7:113552360-113552382 CATCATCACCCAGAAGTAGTGGG + Intergenic
1030997655 7:116377840-116377862 CTTAATCCCCCATAATAAGGGGG + Intronic
1032681951 7:134194152-134194174 CATCACCAGCCAGAATGGGGTGG + Intronic
1036918830 8:12832290-12832312 CTTCATCCCCCAGAGAGTGGGGG - Intergenic
1037509508 8:19567450-19567472 CATCATCCACCAGAAATAGAAGG + Intronic
1042872564 8:73411816-73411838 CATCAATCGCCACAATGAGGAGG - Intergenic
1043950009 8:86298547-86298569 CATCATCACCCAGAAGGCGAGGG + Intronic
1049316990 8:141974620-141974642 CATCATCCACAACAATGATGCGG - Intergenic
1050254392 9:3778957-3778979 CATCATCTTCCAAAATGAAGAGG + Intergenic
1050566249 9:6886990-6887012 CCTCCACCACCAGAATGAGGGGG - Intronic
1051043089 9:12838752-12838774 CATCCTCCCACAGAACAAGGAGG + Intergenic
1052977269 9:34420520-34420542 AATGACCCCCCAAAATGAGGTGG - Intronic
1053417654 9:37956679-37956701 CATCCTCCCCCAGCCTGTGGGGG - Intronic
1053723595 9:40974324-40974346 AATCATCCCCACGAATAAGGGGG - Intergenic
1054342367 9:63877672-63877694 AATCATCCCCACGAATAAGGGGG + Intergenic
1056623822 9:88237559-88237581 AATCAGTCCCCAGAATGAGTAGG - Intergenic
1057421441 9:94916211-94916233 CATCATCGCCCTGATTGGGGAGG + Intronic
1060061690 9:120466363-120466385 CATCATCCCCCAGAATGGGATGG - Intronic
1061679977 9:132238192-132238214 CACCATCCCTAAGAATGGGGGGG - Intronic
1062145675 9:134988449-134988471 CATCTGCCCCCAGTAGGAGGGGG + Intergenic
1186101631 X:6163564-6163586 CACCATCCCACAGAAGGAGCAGG - Intronic
1192423423 X:71053899-71053921 CATCTTCCCCCAGAGTCAGATGG + Intergenic
1193902551 X:87200139-87200161 CCTCATCCCCCAGAAGGAGGTGG - Intergenic
1195668583 X:107451069-107451091 CACCTTCCCCCAGAAGCAGGTGG + Intergenic
1197014127 X:121603985-121604007 CATCAACCCACACAAAGAGGGGG - Intergenic
1200073961 X:153542193-153542215 CCTCGTTCCCCAGAAGGAGGAGG + Intronic