ID: 1163846644

View in Genome Browser
Species Human (GRCh38)
Location 19:19641969-19641991
Sequence CACTCACAACAGTGGCTGTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163846633_1163846644 -2 Left 1163846633 19:19641948-19641970 CCTCCCTGTTCCCCTACTCCCCA 0: 1
1: 0
2: 7
3: 122
4: 1036
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846630_1163846644 17 Left 1163846630 19:19641929-19641951 CCCCTCTGCTTGAGGTCTTCCTC 0: 1
1: 0
2: 2
3: 40
4: 353
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846627_1163846644 25 Left 1163846627 19:19641921-19641943 CCTAAGGCCCCCTCTGCTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846632_1163846644 15 Left 1163846632 19:19641931-19641953 CCTCTGCTTGAGGTCTTCCTCCC 0: 1
1: 0
2: 3
3: 27
4: 285
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846629_1163846644 18 Left 1163846629 19:19641928-19641950 CCCCCTCTGCTTGAGGTCTTCCT 0: 1
1: 0
2: 5
3: 42
4: 312
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846626_1163846644 29 Left 1163846626 19:19641917-19641939 CCTTCCTAAGGCCCCCTCTGCTT 0: 1
1: 0
2: 2
3: 26
4: 275
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846634_1163846644 -5 Left 1163846634 19:19641951-19641973 CCCTGTTCCCCTACTCCCCACTC 0: 1
1: 0
2: 4
3: 67
4: 611
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846631_1163846644 16 Left 1163846631 19:19641930-19641952 CCCTCTGCTTGAGGTCTTCCTCC 0: 1
1: 0
2: 3
3: 30
4: 316
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1163846635_1163846644 -6 Left 1163846635 19:19641952-19641974 CCTGTTCCCCTACTCCCCACTCA 0: 1
1: 0
2: 4
3: 36
4: 451
Right 1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163846644 Original CRISPR CACTCACAACAGTGGCTGTA GGG Exonic
900640385 1:3685543-3685565 CCCTCACAACAGTGGCTGCTGGG + Intronic
901248285 1:7751149-7751171 CAGTAACAACAGGGGCTGCACGG - Intronic
902239721 1:15080458-15080480 CACTCACCACTGTGGCTGCTGGG - Intronic
903374222 1:22855713-22855735 CACCCATAACAGTGTCTGTCTGG - Intronic
903921173 1:26802190-26802212 CACTTAGCACAGTGCCTGTATGG + Intergenic
905695214 1:39968730-39968752 CACTCACCTCAGTGCCTGCAGGG - Exonic
911270050 1:95790365-95790387 CACTCAGAACAGAGGCGGTGGGG - Intergenic
911664778 1:100539853-100539875 CACCCACACCAGTGGCTGCGTGG - Exonic
919040334 1:192379133-192379155 AACTCACAGCAGTGGCTACAGGG + Intergenic
921418483 1:214918720-214918742 CTCTCAGAACAGTGCCTGTCAGG + Intergenic
924439201 1:244072559-244072581 CACTGAAAACAGTGACTGAAAGG - Intergenic
1065132534 10:22636577-22636599 CACTCACCTCATTCGCTGTAGGG + Intronic
1065279521 10:24120501-24120523 CACTCATAAAAGAGGCTATAGGG - Intronic
1067083292 10:43224984-43225006 TGCTCACACCAGTGGCAGTAGGG + Intronic
1072957913 10:99903275-99903297 CAGTCACAACAGTGGGGGTGGGG + Intronic
1073214085 10:101827094-101827116 CACTCTCAACACTGGGTGTCAGG + Intronic
1073724721 10:106216527-106216549 CACTTACAACAGTGTCTATCAGG + Intergenic
1075125909 10:119698658-119698680 CACTCACAGCAGGGGCTGGAGGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075453834 10:122571846-122571868 CACTCAAAAAGGTGGCTGCATGG - Intronic
1075974571 10:126684432-126684454 CAGTCGCAACACAGGCTGTATGG + Intergenic
1076893961 10:133299931-133299953 CACTCCCAACATGGGCCGTACGG + Intronic
1077897676 11:6465718-6465740 CACTCACACCAGCCTCTGTATGG + Exonic
1078577464 11:12514106-12514128 CACTTGGAACAGGGGCTGTAGGG - Intronic
1079714009 11:23721679-23721701 GACTCACAACAGTGCCTTCAAGG - Intergenic
1081698940 11:45140232-45140254 CTCTGACAAGGGTGGCTGTATGG + Intronic
1084851271 11:71942971-71942993 CCCTTACAAAAGTGGCTTTAGGG - Intronic
1087564235 11:99833998-99834020 CACTCACAAAAATGCCTGTCAGG - Intronic
1089394539 11:118127560-118127582 CAAACAAAACAGTGGTTGTAAGG - Intergenic
1095825792 12:46530329-46530351 CTATCACACCAGTGGCTGCAGGG + Intergenic
1096984316 12:55745950-55745972 CACTCCCAACCATGGCTGGAAGG - Intronic
1097083489 12:56450407-56450429 CAGCCACAACAGTGGATGTCAGG + Exonic
1101119011 12:101559983-101560005 AACACACACCAGTGCCTGTAGGG - Intergenic
1101470595 12:104993264-104993286 CAGTCACAACAGAGACAGTAAGG - Intronic
1102534809 12:113573531-113573553 CTGTCACAACATTGGCTCTAGGG - Intergenic
1103814468 12:123642565-123642587 GACCCACAACAGTTGCTGTAGGG + Intronic
1111665884 13:91267338-91267360 CACTCACAGCAGTGCCTCTCAGG + Intergenic
1118959931 14:70519831-70519853 CATTCACAACTTTGGCTGTTTGG - Intergenic
1119641520 14:76318711-76318733 CACCCACAGCAGTGGCTTTGAGG - Intronic
1121998198 14:98623002-98623024 AAATCACAACAGTGGTTGCAGGG + Intergenic
1125805166 15:42487568-42487590 AACTCACAAGAGTGGCTGACTGG - Intronic
1129188578 15:73924920-73924942 CAGTCACACCAGTGGCTCTTTGG + Intergenic
1133281288 16:4666884-4666906 CACTCAGAACACTGGCAGGATGG + Intronic
1133789521 16:8998778-8998800 CACTTAAAACAGTGCCTGAATGG - Intergenic
1140538504 16:75733296-75733318 AACACACAACAGTCCCTGTATGG - Intronic
1140929311 16:79612307-79612329 CACTCACAACAGATGTTTTAGGG - Intergenic
1142761283 17:2043179-2043201 CACTCACAGCAGTGAGTGGAGGG - Exonic
1143218016 17:5239674-5239696 CACTTATAACACTGACTGTAGGG + Intergenic
1147502570 17:40979552-40979574 CACGTAGAACAGTGGCAGTATGG - Intronic
1148350401 17:46937606-46937628 AAATCACAACAGTGGCTGCCTGG - Intronic
1149380403 17:56087839-56087861 TAGTCACAACAGAGCCTGTATGG + Intergenic
1150505085 17:65690744-65690766 CACTCTCAACAGTGACCTTATGG - Intronic
1151582172 17:74986453-74986475 CAATCACCAGAGTGGCTTTAGGG - Intergenic
1152375549 17:79917077-79917099 CACTGCCAGCATTGGCTGTAAGG + Intergenic
1153212072 18:2778448-2778470 GACTCAAAACAGTGTCTGTTAGG + Intronic
1155844980 18:30695021-30695043 CAGCAACAACAGTGGCAGTATGG + Intergenic
1158218388 18:55124348-55124370 CACTCACTGAAGTGGCTATATGG + Intergenic
1160037454 18:75315046-75315068 CTCTCTCTACAGAGGCTGTAGGG - Intergenic
1161214202 19:3085164-3085186 CACTCACAGCAGTGCCTTCATGG - Intergenic
1163605688 19:18274190-18274212 CCCTCACAGCAGGGGCTCTAGGG - Intronic
1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG + Exonic
1165291412 19:34889145-34889167 CTCTCACAACAGTGGCAATGGGG - Intergenic
1165821225 19:38677449-38677471 CACTCAAACAAGTGGCTGGATGG + Intronic
1166573158 19:43812065-43812087 CACTCACAAGACTGGCTGTCAGG + Intronic
1168116529 19:54224021-54224043 CACTCATCACAGTGGCTGTGGGG + Intronic
1168119512 19:54243807-54243829 CACTCATCACAGTGGCTGTGGGG + Intronic
1168168711 19:54572621-54572643 CACTCATCACAGTGGCTGTGGGG - Intergenic
1168176256 19:54630087-54630109 CACTCGTGACAGTGGTTGTACGG - Intronic
1168185067 19:54695342-54695364 CACTCATCACAGTGGCTATGGGG - Intronic
1168484365 19:56748287-56748309 CACTCACAACCAGGGCTGTGGGG + Intergenic
926951350 2:18246901-18246923 CACACACATCAGTGTGTGTAGGG + Intronic
928466458 2:31527401-31527423 CACTCACATCAGAGGCAGCACGG - Intronic
932711472 2:74067753-74067775 CACTGACAACAGTGCCTTTCTGG - Intronic
933534765 2:83557997-83558019 CAGTCAACACTGTGGCTGTAGGG - Intergenic
940181113 2:150934203-150934225 CACTGACAACAGTGGCTTGTAGG - Intergenic
941919062 2:170831072-170831094 CACCCACACCAGTTGCTGGAAGG + Exonic
946174704 2:217915447-217915469 CACTGACAACTGTGGCAGAAAGG + Intronic
946249395 2:218403402-218403424 CACTCACAGCATTGTCTGGATGG - Exonic
946627641 2:221631140-221631162 TAGTCACAACAGGGACTGTATGG - Intergenic
1169267641 20:4176362-4176384 CACACACAAGAGTGTCTGCAGGG + Intronic
1169928465 20:10807478-10807500 CACTAACAAGAGTGGCAGGAAGG + Intergenic
1169928670 20:10808751-10808773 CACTAACAAGAGTGGCAGGAAGG - Intergenic
1172597802 20:36162215-36162237 CACTCTCAACAGTGGCTAATTGG + Intronic
1174380414 20:50152542-50152564 GAGTCACAAAAGTGGGTGTAGGG + Intronic
1178930779 21:36816823-36816845 CCCTCACACCTGTGGATGTAAGG - Intronic
1180239260 21:46489381-46489403 CAGTCACAGCTGTGGCTGTTGGG + Intronic
1181137606 22:20779618-20779640 CACTCACATCAGAGTCTGTCGGG - Exonic
1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG + Intronic
1183032016 22:35113570-35113592 CATTCATAACAGTGGCTAAACGG - Intergenic
1185244445 22:49765709-49765731 CACTCCCCGCAGGGGCTGTAAGG - Intergenic
949554876 3:5144202-5144224 CATTCCCAGCAGTGGCTGTTGGG + Intronic
950633645 3:14300130-14300152 CACTCTCAGCAGTGGTTGTCTGG - Intergenic
951362189 3:21738443-21738465 TACTTACAAAAGTGGCTGTCAGG + Intronic
954408894 3:50360857-50360879 CACTGAAATCAGTGGCTGAAAGG - Intronic
955274502 3:57534217-57534239 CAATCCCAGCAGTGGCTGCATGG - Intronic
955480005 3:59380215-59380237 CCCTCACACCATTGACTGTATGG - Intergenic
956326073 3:68054393-68054415 CACTCACAACAGAAGGTGAAGGG - Intronic
958057733 3:88434743-88434765 CACTCACAGAAGTACCTGTATGG + Intergenic
959807511 3:110574568-110574590 CAGTCACTACAATGGGTGTAGGG - Intergenic
970639940 4:18052611-18052633 CATTCACAAAAGTGGGTGGAAGG + Intergenic
975968514 4:80004898-80004920 CTTTCAGAACAGTGGCTGTCAGG - Intronic
977918245 4:102616803-102616825 CAATCACAACACTGGCTGAGCGG + Exonic
978638582 4:110841636-110841658 CACACACAAGAGTGGCAGGAAGG - Intergenic
979274124 4:118795728-118795750 CAATCACAACTGTGGCTGCCAGG + Intronic
979599971 4:122576641-122576663 CTCTCACAACACTGTCTGAAAGG + Intergenic
979847594 4:125535655-125535677 CACTCACTACCGAGGCTCTAGGG - Intergenic
984578016 4:181474144-181474166 CACACACACCAGGGCCTGTAGGG + Intergenic
986146222 5:5080240-5080262 CACCCACAGCAGTGCCTGTTCGG - Intergenic
987055213 5:14184817-14184839 GAAGCACAGCAGTGGCTGTAGGG - Intronic
992778404 5:80107428-80107450 AACCCACAACAGTGGCTTTGGGG + Intergenic
998058022 5:139096082-139096104 CCCCCCCAACAGTGGCAGTATGG + Intronic
998873298 5:146574656-146574678 CAGTCACAACAGAGACTGTATGG + Intergenic
1003578816 6:7320993-7321015 CACTGACAGCAGTGGGAGTAAGG + Intronic
1006296498 6:33172282-33172304 CACTCACAGCAGTGCCTGGGAGG + Exonic
1006449057 6:34095562-34095584 CACTCAGAACAGTGCCTGGCAGG + Intronic
1007665169 6:43509507-43509529 CACTCACAAGAGGGACTGGATGG + Exonic
1008427167 6:51372707-51372729 CACTCACAAAAGGGGTTGCATGG - Intergenic
1010750745 6:79614077-79614099 CTCTCACTACAGGGACTGTAGGG - Intergenic
1017454526 6:154589101-154589123 CTCTCTCTTCAGTGGCTGTAGGG + Intergenic
1020017910 7:4842253-4842275 CTCTCACAGCAGAGGCCGTAAGG + Intronic
1020400155 7:7767642-7767664 CACTCACAACAGTAACAGTTAGG + Intronic
1030928642 7:115493210-115493232 CACACACAAGATTGACTGTATGG - Intergenic
1034256487 7:149727480-149727502 AACTCACAGCAGTGGCAGGAGGG - Intronic
1036544500 8:9753914-9753936 TACTCCCTACAGAGGCTGTAGGG + Intronic
1037332977 8:17762947-17762969 CAAAAACAACAGTGGCTGTCAGG + Intronic
1037789826 8:21927897-21927919 CACTCACAAAAGTGGATATTTGG + Intronic
1040878011 8:52173467-52173489 CACTGACAACAATGGCTGCCTGG - Intronic
1044651038 8:94495585-94495607 AATACACAACAGAGGCTGTATGG + Intronic
1046413804 8:113884162-113884184 CAATCAGCACAGTAGCTGTAGGG + Intergenic
1048024036 8:130567810-130567832 CAATGGCAGCAGTGGCTGTAGGG - Intergenic
1048267222 8:132998326-132998348 CACTGAAAGCAGTGGCTGCAAGG + Intronic
1051212860 9:14763543-14763565 CACTTACAACAGTGGTTTTCAGG - Intronic
1052013909 9:23443238-23443260 GAATCACAATAGTTGCTGTATGG - Intergenic
1052446880 9:28574392-28574414 CACACTAAACAGTGACTGTATGG - Intronic
1052824611 9:33166286-33166308 CACTCAGGAGAGTGGCTCTATGG + Intronic
1054971371 9:71091444-71091466 CCCTTACAACAGTGGCTGTTTGG + Intronic
1057504116 9:95618492-95618514 CACTCACAAGACTGGGTTTAGGG + Intergenic
1058759502 9:108117335-108117357 CACTCACACTAGAGTCTGTACGG - Intergenic
1061587502 9:131578454-131578476 CACTGACAGCACTGGCTGAAAGG + Exonic
1185627708 X:1494086-1494108 GACTTACAACGGTGGCTGCAGGG + Intronic
1190492807 X:50999830-50999852 CACTGAAAACAGTAACTGTAGGG - Intergenic
1191174464 X:57484693-57484715 CACTCACCACATGGGCTGAAAGG - Intronic
1191739135 X:64418229-64418251 CACTCATACCAGTGGCTGGCTGG + Intergenic
1192069523 X:67922496-67922518 CATTCTCAGCAGTGGCTGCATGG + Intergenic
1194990663 X:100543555-100543577 CATTCACAACTGTGGTGGTATGG + Intergenic
1200295795 X:154918650-154918672 AACTCAAAACAGAGGCTGTGAGG - Intronic
1200464397 Y:3496912-3496934 CAATCACAAAAATGTCTGTATGG + Intergenic
1201528380 Y:14962245-14962267 CACACACAACAGTGTCTGGATGG - Intergenic