ID: 1163847176

View in Genome Browser
Species Human (GRCh38)
Location 19:19644142-19644164
Sequence GCTCCCTGGTGTGCTGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163847176_1163847183 2 Left 1163847176 19:19644142-19644164 CCAATTACAGCACACCAGGGAGC No data
Right 1163847183 19:19644167-19644189 CCCTTTTAGGTAGGGAGTGGAGG No data
1163847176_1163847186 27 Left 1163847176 19:19644142-19644164 CCAATTACAGCACACCAGGGAGC No data
Right 1163847186 19:19644192-19644214 TGTCCAAAAGCACCAGCTCTGGG No data
1163847176_1163847180 -6 Left 1163847176 19:19644142-19644164 CCAATTACAGCACACCAGGGAGC No data
Right 1163847180 19:19644159-19644181 GGGAGCAGCCCTTTTAGGTAGGG No data
1163847176_1163847179 -7 Left 1163847176 19:19644142-19644164 CCAATTACAGCACACCAGGGAGC No data
Right 1163847179 19:19644158-19644180 AGGGAGCAGCCCTTTTAGGTAGG No data
1163847176_1163847185 26 Left 1163847176 19:19644142-19644164 CCAATTACAGCACACCAGGGAGC No data
Right 1163847185 19:19644191-19644213 TTGTCCAAAAGCACCAGCTCTGG No data
1163847176_1163847187 28 Left 1163847176 19:19644142-19644164 CCAATTACAGCACACCAGGGAGC No data
Right 1163847187 19:19644193-19644215 GTCCAAAAGCACCAGCTCTGGGG No data
1163847176_1163847181 -1 Left 1163847176 19:19644142-19644164 CCAATTACAGCACACCAGGGAGC No data
Right 1163847181 19:19644164-19644186 CAGCCCTTTTAGGTAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163847176 Original CRISPR GCTCCCTGGTGTGCTGTAAT TGG (reversed) Intergenic
No off target data available for this crispr