ID: 1163847690

View in Genome Browser
Species Human (GRCh38)
Location 19:19646667-19646689
Sequence GGAGTCCCCGGTGGCTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 368}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163847690_1163847706 30 Left 1163847690 19:19646667-19646689 CCCCTCCAGCCACCGGGGACTCC 0: 1
1: 0
2: 6
3: 35
4: 368
Right 1163847706 19:19646720-19646742 TGTGTCCAGTTCCTGGCCGCTGG 0: 1
1: 0
2: 1
3: 15
4: 210
1163847690_1163847700 3 Left 1163847690 19:19646667-19646689 CCCCTCCAGCCACCGGGGACTCC 0: 1
1: 0
2: 6
3: 35
4: 368
Right 1163847700 19:19646693-19646715 CGTCAGCCCATGCCTGTTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
1163847690_1163847699 2 Left 1163847690 19:19646667-19646689 CCCCTCCAGCCACCGGGGACTCC 0: 1
1: 0
2: 6
3: 35
4: 368
Right 1163847699 19:19646692-19646714 GCGTCAGCCCATGCCTGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1163847690_1163847698 1 Left 1163847690 19:19646667-19646689 CCCCTCCAGCCACCGGGGACTCC 0: 1
1: 0
2: 6
3: 35
4: 368
Right 1163847698 19:19646691-19646713 TGCGTCAGCCCATGCCTGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 87
1163847690_1163847704 23 Left 1163847690 19:19646667-19646689 CCCCTCCAGCCACCGGGGACTCC 0: 1
1: 0
2: 6
3: 35
4: 368
Right 1163847704 19:19646713-19646735 GGGCCTTTGTGTCCAGTTCCTGG 0: 1
1: 0
2: 3
3: 32
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163847690 Original CRISPR GGAGTCCCCGGTGGCTGGAG GGG (reversed) Intronic