ID: 1163848400

View in Genome Browser
Species Human (GRCh38)
Location 19:19650221-19650243
Sequence TAGGGGGCCTTGCATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163848400_1163848413 18 Left 1163848400 19:19650221-19650243 CCCACCTCATGCAAGGCCCCCTA 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1163848413 19:19650262-19650284 GGGGCTATTGCGCTCTCCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 44
1163848400_1163848412 17 Left 1163848400 19:19650221-19650243 CCCACCTCATGCAAGGCCCCCTA 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1163848412 19:19650261-19650283 GGGGGCTATTGCGCTCTCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 54
1163848400_1163848407 -4 Left 1163848400 19:19650221-19650243 CCCACCTCATGCAAGGCCCCCTA 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1163848407 19:19650240-19650262 CCTAACCTGAAACACACAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 183
1163848400_1163848410 -1 Left 1163848400 19:19650221-19650243 CCCACCTCATGCAAGGCCCCCTA 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1163848410 19:19650243-19650265 AACCTGAAACACACAGAAGGGGG 0: 1
1: 0
2: 0
3: 36
4: 318
1163848400_1163848409 -2 Left 1163848400 19:19650221-19650243 CCCACCTCATGCAAGGCCCCCTA 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1163848409 19:19650242-19650264 TAACCTGAAACACACAGAAGGGG 0: 1
1: 0
2: 1
3: 26
4: 260
1163848400_1163848408 -3 Left 1163848400 19:19650221-19650243 CCCACCTCATGCAAGGCCCCCTA 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1163848408 19:19650241-19650263 CTAACCTGAAACACACAGAAGGG 0: 1
1: 0
2: 3
3: 15
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163848400 Original CRISPR TAGGGGGCCTTGCATGAGGT GGG (reversed) Intronic
900611468 1:3546369-3546391 TTGGGGGCCATGCAGGAGGAAGG - Intronic
900933738 1:5752612-5752634 TAGGAGGCCATGAATGGGGTGGG + Intergenic
903352832 1:22728539-22728561 TGTGGGGCCTGGCATGAAGTAGG + Intronic
903971978 1:27124865-27124887 TGGGGGGCCTTCCCAGAGGTGGG + Intronic
905252538 1:36658874-36658896 TAGGGAGCCTAGCAGGAGATTGG + Intergenic
906312080 1:44761203-44761225 TAGGAGTCCTTTCATGAGGAAGG + Intronic
906665275 1:47617045-47617067 TAGGTGTCCATGCCTGAGGTTGG - Intergenic
907106526 1:51887786-51887808 AATGGGGCCTGGCATGTGGTAGG + Intergenic
907403219 1:54238477-54238499 CAGGGGGCGTTGCCCGAGGTCGG - Intronic
907870560 1:58438972-58438994 TAGGGAGGGTGGCATGAGGTGGG + Intronic
908569821 1:65397562-65397584 TGTGGTGCCTTGCATGTGGTAGG + Intronic
908579493 1:65499637-65499659 TAGGGGGCCTGGCATGTGTTAGG + Intronic
909473175 1:76052579-76052601 TATGAGGCCTGGCATGTGGTTGG - Intergenic
916823350 1:168421766-168421788 GAGGTGGCTTTGCATGAGGATGG + Intergenic
917236163 1:172893738-172893760 GAGGAGGCTGTGCATGAGGTGGG + Intergenic
919644189 1:200076809-200076831 TAGGTGGCATTGCATGATCTTGG + Intronic
924246374 1:242089505-242089527 TAGGAAGCTTAGCATGAGGTGGG - Exonic
1070094081 10:73319447-73319469 TAGGGGGGCTTGCAAGTGGTAGG - Intronic
1072565533 10:96613867-96613889 TAGGGAGCATTGAATGAGTTGGG - Intronic
1074824595 10:117205629-117205651 AAGGGGGCTTTGGCTGAGGTGGG - Intronic
1076393270 10:130119799-130119821 TAGGGAGCCTGGCATGGAGTAGG + Intergenic
1077222007 11:1422005-1422027 CAGGGGGTCTAGCCTGAGGTTGG + Intronic
1079094483 11:17501826-17501848 TTGGGGTCCTGGGATGAGGTGGG - Intronic
1080264787 11:30389250-30389272 TCGGGAGCCTTGACTGAGGTTGG + Intronic
1088674896 11:112182689-112182711 TGGGGGGCCTGTCATGGGGTGGG + Intronic
1088769588 11:113020326-113020348 AAGAGGCCCTTGCATGAGGCAGG + Intronic
1089215634 11:116833003-116833025 AGGGGGGCCAGGCATGAGGTGGG - Exonic
1094204924 12:27829924-27829946 TAGTGGGCATTGGGTGAGGTTGG + Intergenic
1096485104 12:51974926-51974948 TAGGTGGCTCTGCATGAAGTGGG + Intronic
1096519281 12:52174987-52175009 GAGGGGGCCAGGCAGGAGGTGGG + Intronic
1103940011 12:124496378-124496400 GAGAGGGCTTTGCATGAGGCAGG - Intronic
1107378884 13:39834150-39834172 TTGGGTGCCTTGCATGAGGCTGG - Intergenic
1109537253 13:63737904-63737926 TGTGGGGCCCTGGATGAGGTCGG - Intergenic
1109546983 13:63843671-63843693 TGTGGGGCCTTGGATGAGGCCGG + Intergenic
1112492619 13:99880926-99880948 TTGGGGGTCGTGCAGGAGGTTGG - Intronic
1113378319 13:109783613-109783635 TAGGGGGCCTTGTAGGAGCGGGG + Exonic
1116645587 14:47524794-47524816 GAGGGGGCCTTCCATGAGGTGGG + Intronic
1117065955 14:52013652-52013674 TGGGGTGCCTTGCATTAGGGAGG + Intronic
1118748581 14:68791078-68791100 TTGGGGGCCTGGTCTGAGGTTGG + Intronic
1119382443 14:74237975-74237997 TAAGGGGCCTGGGATGATGTAGG + Intergenic
1122010029 14:98738672-98738694 GAGGGAGCCTGGCATGAGGGTGG - Intergenic
1124659031 15:31530227-31530249 TTGGGAGCAGTGCATGAGGTTGG - Intronic
1126206626 15:46053130-46053152 TAGGGGCCCTGGGAGGAGGTGGG + Intergenic
1128291638 15:66482678-66482700 CATGGGGCCTGGCATGTGGTAGG + Intronic
1128532239 15:68462288-68462310 TGGGTGACCTTGCATGAGGCTGG + Intergenic
1128706813 15:69842678-69842700 CAGGTGGCCTGGCATGAGGTAGG + Intergenic
1129174776 15:73832128-73832150 CAGGGTCCCTGGCATGAGGTAGG - Intergenic
1129691157 15:77714390-77714412 CAGGGGGCCGTGAATGAGCTTGG - Intronic
1132660126 16:1057620-1057642 CAGTGGGCCCTGCGTGAGGTCGG - Intergenic
1133859077 16:9577036-9577058 AAGGGGGCCTGTCAGGAGGTGGG - Intergenic
1138599947 16:58048199-58048221 GGGGGGGCTTTGCATGAGGAGGG + Intergenic
1140555453 16:75916118-75916140 GAGGGGGCCTTGAATGTGGCAGG + Intergenic
1140743242 16:77960201-77960223 TAGGGGGTCTTGTAGGGGGTTGG + Intronic
1142740166 17:1927280-1927302 CACTGGGCCTAGCATGAGGTTGG + Intergenic
1142759743 17:2035472-2035494 GAGGGGGCCCTGCCTGTGGTGGG + Intronic
1143041820 17:4043755-4043777 TAGGGGACCTTGAATGTGCTAGG - Intronic
1146915046 17:36673053-36673075 TGGGGGGCCTTGGGTGAGGCAGG + Intergenic
1149962262 17:61123541-61123563 TATGGGGCCTTACATGGAGTGGG + Intronic
1151031425 17:70744748-70744770 TAGGAGTCCTGGCATGATGTTGG - Intergenic
1151345462 17:73498730-73498752 TGTGGGGCCTGGCATGAGGTAGG + Intronic
1156046169 18:32879937-32879959 TGGGGTGCCTTTCATGAGATGGG + Intergenic
1161375742 19:3938158-3938180 TAGCGGGCATTGCAGGAGGGTGG - Intronic
1163038349 19:14584624-14584646 TGGTGGGACTTGCCTGAGGTAGG + Intronic
1163039044 19:14588885-14588907 TGGTGGGACTTGCCTGAGGTAGG + Intronic
1163848400 19:19650221-19650243 TAGGGGGCCTTGCATGAGGTGGG - Intronic
1165081112 19:33306525-33306547 TCGTGGGCCTTGCATTAGGAAGG - Intergenic
1165764960 19:38344466-38344488 TGTGGGGCCTGGCATGAAGTTGG - Intronic
1165968413 19:39604454-39604476 TATGGGGCCCTGAATGCGGTAGG + Intronic
1166293856 19:41879448-41879470 TCTGGGGCCTTGCAGGAGGTGGG + Intronic
927843142 2:26457803-26457825 TGGGGAGCCTTGGATGGGGTGGG - Exonic
929077655 2:38091838-38091860 AAGGGTGCCTGGCATGTGGTGGG + Intronic
932702132 2:73999408-73999430 TATGGGGCCTGACATGGGGTTGG + Intronic
932840026 2:75073447-75073469 AAGGGGACCATACATGAGGTTGG + Intronic
937298903 2:120826524-120826546 TGTGGGACCTTGCTTGAGGTGGG + Intronic
947267059 2:228294476-228294498 TAGGGTGCCCTGGATGAGGAGGG + Intergenic
948064900 2:235070286-235070308 TAGGGAGCCTGGGGTGAGGTGGG + Intergenic
948221927 2:236276795-236276817 TATGGGGACTTGCAGGAAGTAGG + Intergenic
1170569202 20:17623372-17623394 TGGAGGCCCTTTCATGAGGTAGG + Intronic
1174873123 20:54201716-54201738 AAGTGGGCCCTGCATGAGGCAGG + Intergenic
1175387056 20:58604206-58604228 GAGGGGGCTTTGGATGAGGTGGG + Intergenic
1177133704 21:17287928-17287950 TGGGGGGCCTGTCATGTGGTGGG + Intergenic
1181728531 22:24828019-24828041 AAGGGGGCCTTTCAGGAGATAGG - Intronic
1182372160 22:29818963-29818985 CAGGAGGCCTTGTAGGAGGTGGG - Intronic
1185186533 22:49404260-49404282 TGGGGGCCCTTGTCTGAGGTCGG + Intergenic
949461936 3:4303345-4303367 TAGTGGGCGTTGCGTGAGGCGGG + Exonic
952952812 3:38538493-38538515 ATGGGGGCCTTGCAGCAGGTGGG + Intronic
957777043 3:84766985-84767007 AAGGGGGCCTATCAGGAGGTGGG + Intergenic
962494775 3:135928128-135928150 TAGGGTGCAGTGGATGAGGTGGG + Intergenic
964759615 3:160122324-160122346 TAGGGGGCTGTGCTAGAGGTGGG + Intergenic
966862362 3:184237434-184237456 TAGGGGGGCTAGGGTGAGGTAGG + Intronic
968815549 4:2819872-2819894 TAGGGGGCAGGGCATGATGTTGG + Intronic
969328869 4:6461416-6461438 TAGAGCCCCTTGCATTAGGTGGG + Intronic
970502724 4:16694567-16694589 AAGAAGGCCTTGCAGGAGGTGGG - Intronic
985672409 5:1213404-1213426 TGGGGGGCCAGGCATGCGGTGGG - Intronic
986023834 5:3831315-3831337 TAGCTGGGCTGGCATGAGGTAGG + Intergenic
986462183 5:7983574-7983596 TAGGGAGCCTGAGATGAGGTCGG + Intergenic
987039520 5:14048703-14048725 TAGGGTGCCTGGGTTGAGGTAGG - Intergenic
995130666 5:108627002-108627024 AAGTGGGCCTGGCTTGAGGTGGG - Intergenic
997354496 5:133253649-133253671 TAGGGGGCCTGGGATGGGGCAGG - Intronic
998094762 5:139390951-139390973 GAGGGGGGTCTGCATGAGGTGGG - Exonic
999921729 5:156328935-156328957 AAGGGAGCCTTCCATGAGCTCGG + Intronic
1001044078 5:168358051-168358073 TTGGGACCCTTGCATGTGGTGGG + Intronic
1001927248 5:175647308-175647330 TAGGGTGCCTACCATGTGGTAGG + Intergenic
1003282476 6:4706040-4706062 GAGGGGGCCTTTTATGAGGCAGG + Intergenic
1005397402 6:25397307-25397329 AAGGGGGCCTTGCAGGCTGTTGG + Intronic
1006916170 6:37595170-37595192 AAGGGGCCCTTGCCTGAGTTTGG - Intergenic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1008028985 6:46672000-46672022 TATAGGGCTTTGCATGATGTAGG - Intronic
1008056973 6:46955385-46955407 TAGGGGGTCTTGCCTGAGGCTGG - Intergenic
1009573657 6:65423699-65423721 TATGTGGCCTTGCTTGAGTTGGG - Intronic
1024733111 7:52274305-52274327 GAGGGGGCCTTGGCTGGGGTGGG - Intergenic
1026071523 7:67125360-67125382 TTGGGGGTATTGCATAAGGTAGG + Intronic
1027196192 7:76032162-76032184 TAGGGGGGATTGCTTGAGGCTGG + Intronic
1032191242 7:129767161-129767183 TATGGGGCCTGGCATGTGGCAGG - Intergenic
1034498163 7:151434056-151434078 TAGGAGGCCTTTCCTGGGGTCGG - Intronic
1034735965 7:153429880-153429902 TAGGGTGTCTTGGATGAGGAGGG - Intergenic
1034747268 7:153534019-153534041 AAGGGAGCCTTGTATGAGTTAGG + Intergenic
1035075856 7:156176839-156176861 GAGGGGGCCTTGAATGAGGTGGG + Intergenic
1035132776 7:156670835-156670857 AAGGATGCCTTGCATGAGGAAGG + Intronic
1037908292 8:22728182-22728204 TGGGAGGCCCTGCTTGAGGTGGG + Intronic
1039576877 8:38630641-38630663 TAGGGAGCATCTCATGAGGTAGG + Intergenic
1041219167 8:55632054-55632076 TAAGGGGCCTTACAGGAGATTGG - Intergenic
1044939120 8:97322448-97322470 ACGGGGGCCTGTCATGAGGTCGG - Intergenic
1048046584 8:130778587-130778609 TTTGGGGCCTTGCATGAATTTGG + Intergenic
1049519079 8:143079152-143079174 TCAGGGGTCTTGCAGGAGGTAGG - Intergenic
1051104024 9:13557490-13557512 TAAGGGGCCTTGAAGGAAGTTGG - Intergenic
1052860427 9:33434823-33434845 GAGGCGGCCTGGCTTGAGGTGGG - Intergenic
1055240025 9:74172518-74172540 TTGGGGGCCTTGCATGAATTTGG + Intergenic
1057268098 9:93631964-93631986 TGGGGGCTCTTGCATGAGTTGGG + Intronic
1060205943 9:121682940-121682962 TAGGGGGCCCTGAATGAGGATGG + Intronic
1061668612 9:132175182-132175204 TACAGGGGCTTGGATGAGGTGGG - Intronic
1189747660 X:44186628-44186650 CAGGGGGCCTTACATGATGAAGG + Intronic
1195119574 X:101736739-101736761 GAGAGGCCCTTTCATGAGGTGGG - Intergenic
1195617840 X:106927242-106927264 TATAGGGCTTTGCATGAGGCAGG - Intronic
1198600600 X:138281239-138281261 AAGGGGGCCTTGCAGAAGCTTGG - Intergenic
1200165515 X:154032638-154032660 CCTGGGGCCTTGCATGTGGTGGG - Intronic