ID: 1163849343

View in Genome Browser
Species Human (GRCh38)
Location 19:19654556-19654578
Sequence CCATGCTGACGGCCGTGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163849343_1163849348 -9 Left 1163849343 19:19654556-19654578 CCAGTCCACGGCCGTCAGCATGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1163849348 19:19654570-19654592 TCAGCATGGCCTTCTCTAGAGGG 0: 1
1: 0
2: 0
3: 14
4: 162
1163849343_1163849347 -10 Left 1163849343 19:19654556-19654578 CCAGTCCACGGCCGTCAGCATGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1163849347 19:19654569-19654591 GTCAGCATGGCCTTCTCTAGAGG 0: 1
1: 0
2: 1
3: 7
4: 119
1163849343_1163849350 3 Left 1163849343 19:19654556-19654578 CCAGTCCACGGCCGTCAGCATGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1163849350 19:19654582-19654604 TCTCTAGAGGGTCACCCACGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1163849343_1163849351 4 Left 1163849343 19:19654556-19654578 CCAGTCCACGGCCGTCAGCATGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1163849351 19:19654583-19654605 CTCTAGAGGGTCACCCACGAGGG 0: 1
1: 0
2: 1
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163849343 Original CRISPR CCATGCTGACGGCCGTGGAC TGG (reversed) Exonic
900299634 1:1970228-1970250 CCAGGTGGACGGCCCTGGACAGG + Intronic
909110226 1:71466356-71466378 CCTTGCTGGAGGCCCTGGACAGG + Intronic
918058786 1:181044910-181044932 TCAGGCTGAGGGCCGGGGACTGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922223435 1:223626205-223626227 CCATGCTGATGGCTCTGGACAGG + Intronic
922466390 1:225847885-225847907 CCTTCCTGACAGCCGTGGCCAGG - Intronic
924581827 1:245330346-245330368 CCAGGCAGAAGGCCATGGACAGG + Intronic
1069605867 10:69738246-69738268 CCCTGCTGCTGGCCCTGGACTGG + Intergenic
1070819192 10:79345154-79345176 CCATGCTGAGGACTCTGGACTGG - Intergenic
1079058580 11:17228374-17228396 CCAGGGTAGCGGCCGTGGACTGG + Intronic
1085456129 11:76666308-76666330 CCATGCTCAGGGCCAGGGACTGG + Intronic
1086258577 11:84910065-84910087 CCTTGCTGACTGCAGTGGACTGG + Intronic
1086926732 11:92648780-92648802 CCATGCTCATTGCCTTGGACTGG + Intronic
1087304596 11:96473351-96473373 CCATGCTGAGGCCCAAGGACAGG + Intronic
1088794975 11:113260198-113260220 TCATGCTGAAGTCCCTGGACTGG + Exonic
1089554914 11:119310970-119310992 CCATCTTGTCGGCCCTGGACTGG - Intronic
1089652412 11:119922904-119922926 GCATGCTGATGGGGGTGGACTGG - Intergenic
1092182212 12:6453484-6453506 CCATGCTGACTGCAGTGGGAAGG + Exonic
1096969523 12:55654642-55654664 CCATGCTGAATGCTGTGGACCGG - Intergenic
1098991723 12:77071156-77071178 CCATGCTGAAGGCAGAGGCCGGG + Intergenic
1100428611 12:94510215-94510237 CCCTGCTGATGGCTGTGGAAGGG - Intergenic
1104909863 12:132235550-132235572 CCATGCTGACCACCCTGGAGGGG - Intronic
1111912545 13:94328597-94328619 CCATGCTGCTGGCTGTGGATGGG - Intronic
1113615869 13:111680458-111680480 CTGTGCTGCCCGCCGTGGACGGG - Intergenic
1113621337 13:111765351-111765373 CTGTGCTGCCCGCCGTGGACGGG - Intergenic
1125256982 15:37775951-37775973 GCATTCTGAAGGCCGTTGACTGG - Intergenic
1125734720 15:41916740-41916762 CCATGCTGAGGAACGGGGACAGG - Intronic
1132050811 15:98606366-98606388 CCATCTTGGCGGCCGTGGAGAGG - Intergenic
1139415102 16:66801608-66801630 CCAGGCTCACGTCCGTGGGCGGG + Exonic
1141635268 16:85311023-85311045 CATTGCTGACGGCCGCGGAAAGG - Intergenic
1142884786 17:2905781-2905803 CCATGGGGACTGCCGTGAACAGG - Intronic
1145023012 17:19446726-19446748 CCAGGGTCGCGGCCGTGGACGGG - Intergenic
1147195287 17:38762445-38762467 CCATGCTGAATGCTGTGGACCGG + Exonic
1147436220 17:40417788-40417810 CCATGGTGACGGTCGTGAAGGGG + Exonic
1148193280 17:45695095-45695117 CAATGCTGAGGGCCATGGCCAGG + Intergenic
1149659929 17:58328887-58328909 CCATGGTGATGGCGCTGGACTGG + Intergenic
1151543299 17:74776392-74776414 CCATGCTGACGGCAGCCGCCAGG + Intergenic
1159726720 18:71969844-71969866 CCATGCTGCCAGCCGTGCAGTGG - Intergenic
1160701854 19:511340-511362 CCATGATGACGGCAGGAGACAGG - Intronic
1161298607 19:3532198-3532220 CCCTGCTGATGGCTGTGGAGTGG - Intronic
1162896012 19:13765005-13765027 CCATGTTGACAGCGGTGGGCCGG - Exonic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
1163849343 19:19654556-19654578 CCATGCTGACGGCCGTGGACTGG - Exonic
925103240 2:1267293-1267315 CCATGCTGAGGGCCCTGGTGTGG - Intronic
926310213 2:11669607-11669629 CCATGATGACGGCCATGGGCAGG + Exonic
929021272 2:37555672-37555694 CCAGGCTGGCGGCCGTGGTTGGG + Intergenic
929931275 2:46257488-46257510 CCAGGCTGTCGGCCCTGGAAAGG + Intergenic
932216334 2:69968735-69968757 CCATGCAGACGGCCCAGGAGTGG - Intergenic
932644520 2:73487313-73487335 GCATGCTGACGGCTGTGGTAGGG + Intronic
942189504 2:173456305-173456327 CCATGCTGGGGGCAGGGGACAGG + Intergenic
946016781 2:216610429-216610451 CCATGCTGAATGCTGTGGACTGG - Intergenic
946966592 2:225042824-225042846 TGAGGCTGACGGCCTTGGACAGG - Intergenic
1172336687 20:34122520-34122542 CCAGGGTCATGGCCGTGGACTGG + Intergenic
1175758500 20:61545343-61545365 CAATTCTGCCGGCCGTGGGCTGG + Intronic
1175935763 20:62513327-62513349 CCATGGTGGCCGCCGTGGACAGG + Intergenic
1179419591 21:41224770-41224792 CCATGCTAACGGGTGTGGAACGG - Intronic
1180840755 22:18957811-18957833 CCAGGCTGCCTGCAGTGGACCGG + Intergenic
1181060730 22:20280963-20280985 CCAGGCTGCCTGCAGTGGACCGG - Intronic
1184806579 22:46798500-46798522 CCATGTGGACTGCCGTGGCCAGG + Intronic
956080309 3:65549673-65549695 CCATCCTCAGGGCCTTGGACGGG + Intronic
964137164 3:153357140-153357162 CCATGCTAACGCCTGTGGGCAGG - Intergenic
969913315 4:10464929-10464951 CCATTCTGACTGCCGTGAAATGG + Intergenic
971439704 4:26668420-26668442 CCCTGCTGAGGGCCAGGGACTGG + Intronic
985201054 4:187485919-187485941 CAATGCTGACAGCAGTGGGCTGG - Intergenic
985643210 5:1073346-1073368 CCATGATTACGGCTCTGGACGGG + Intronic
1002097640 5:176840824-176840846 CCACGCTGACAGCCCTGGAAAGG + Intronic
1004044650 6:12012313-12012335 CCACGCTGAAGGCCGGCGACTGG - Intronic
1006368955 6:33632835-33632857 CCACGCTGAGTGCCGAGGACAGG - Intronic
1012157747 6:95840942-95840964 CCATGTTTACGGCAGTGGAGGGG + Intergenic
1017053760 6:150419361-150419383 CGATGGTGACGGCCCTGGAGTGG + Intergenic
1023538563 7:41240159-41240181 CCAGGCTGAGGGCTGTGGCCTGG - Intergenic
1024007935 7:45241238-45241260 CCATGCTGATGGGCTTGGAGGGG + Intergenic
1024049258 7:45608582-45608604 CCATGCTGGGGGCCGTGTGCGGG + Intronic
1027904788 7:84165751-84165773 CCATGCTGATGGACCTGGTCTGG + Intronic
1029694591 7:102204529-102204551 CCTTGCTGCTGGCCCTGGACGGG - Exonic
1030509985 7:110472255-110472277 TCATGCTGACAGCTGTAGACTGG - Intergenic
1038492402 8:27980554-27980576 CCATGCAGACGGGCATGGCCTGG - Intronic
1040342557 8:46448312-46448334 CCATGCTGCCGCCCGAGGAGGGG + Intergenic
1048835235 8:138513004-138513026 CTCTGCTGAAGGCCGGGGACAGG + Intergenic
1049280170 8:141740129-141740151 CCATGCTGATGGGGGTGGAGTGG + Intergenic
1049692656 8:143969408-143969430 CCGTGCTGAGGGCTGTGGGCTGG + Intronic
1049692974 8:143970889-143970911 CCGTGCTGAGGGCTGTGGGCTGG - Intronic
1052437111 9:28443747-28443769 CCATGCTGAGGGCCGCCCACAGG - Intronic
1059463751 9:114452309-114452331 ACATGCTGACGGCAGAGAACCGG + Intronic
1061949595 9:133929037-133929059 CCATGCCGAGGGCTGTGGGCGGG - Intronic
1199793572 X:151176171-151176193 CCCTGCTGGGGGCTGTGGACTGG + Intergenic