ID: 1163850991

View in Genome Browser
Species Human (GRCh38)
Location 19:19663551-19663573
Sequence CCGCGCGCGCTCCTTGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163850991_1163851000 7 Left 1163850991 19:19663551-19663573 CCGGCGGCAAGGAGCGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1163851000 19:19663581-19663603 CCGGGCTTGGGCTGCCCGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 109
1163850991_1163851005 26 Left 1163850991 19:19663551-19663573 CCGGCGGCAAGGAGCGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1163851005 19:19663600-19663622 CAGGCCGGACCCCGCAAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 125
1163850991_1163850997 -5 Left 1163850991 19:19663551-19663573 CCGGCGGCAAGGAGCGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1163850997 19:19663569-19663591 CGCGGCTGCGGCCCGGGCTTGGG 0: 1
1: 0
2: 0
3: 25
4: 259
1163850991_1163851004 22 Left 1163850991 19:19663551-19663573 CCGGCGGCAAGGAGCGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1163851004 19:19663596-19663618 CCGTCAGGCCGGACCCCGCAAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1163850991_1163851001 11 Left 1163850991 19:19663551-19663573 CCGGCGGCAAGGAGCGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1163851001 19:19663585-19663607 GCTTGGGCTGCCCGTCAGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 169
1163850991_1163850996 -6 Left 1163850991 19:19663551-19663573 CCGGCGGCAAGGAGCGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1163850996 19:19663568-19663590 GCGCGGCTGCGGCCCGGGCTTGG 0: 1
1: 0
2: 2
3: 48
4: 477
1163850991_1163851006 27 Left 1163850991 19:19663551-19663573 CCGGCGGCAAGGAGCGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1163851006 19:19663601-19663623 AGGCCGGACCCCGCAAGGCCGGG 0: 1
1: 0
2: 0
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163850991 Original CRISPR CCGCGCGCGCTCCTTGCCGC CGG (reversed) Exonic
900418700 1:2546422-2546444 CCCCGCGCGCTCGTTGAGGCCGG + Intergenic
901086368 1:6614268-6614290 CCGCGCTCGGTCCTCTCCGCCGG + Intronic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
914393480 1:147242711-147242733 GCGCGGGCGCTACTAGCCGCGGG + Exonic
918215913 1:182391860-182391882 CGGCCCGGGCTCCTGGCCGCTGG - Exonic
922925409 1:229343088-229343110 CCACGCGCGCTCCCGGCCCCCGG + Intronic
923782935 1:237042217-237042239 CCGCGCTCGCTGCCTGCAGCCGG - Exonic
924090105 1:240492923-240492945 CCCCGCGCGCGCCCGGCCGCTGG - Exonic
1069695550 10:70382789-70382811 GCCCGCGCGCTCCCGGCCGCAGG + Intergenic
1074165866 10:110872631-110872653 CCGCGCGCTATCCTCGCCGGGGG + Intronic
1076380393 10:130021228-130021250 CCGCGGGGGCTCCTTGTCCCCGG + Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1076814315 10:132907124-132907146 CCTGGGGCGCTCCTTGCCTCCGG + Intronic
1077014714 11:394442-394464 CCGCGCCCGCCTCTTGCAGCTGG + Exonic
1077360805 11:2139471-2139493 CCGCGGGCGCCCATTGGCGCGGG - Intronic
1083747677 11:64744750-64744772 CGGTGCGGGCTCCTTGCGGCAGG - Intronic
1086888222 11:92226688-92226710 CCGCCCACGCTCCGGGCCGCAGG - Intergenic
1097188963 12:57210499-57210521 CCACGCCTGCTCCTTGCCCCTGG + Intronic
1101692413 12:107093999-107094021 CCGAGCGCGCTCCTGCCCGCCGG - Intergenic
1103392478 12:120584603-120584625 CGGCGCGCGCTAATTACCGCGGG - Intergenic
1110860606 13:80341421-80341443 CCGCCAGCGCTCCGAGCCGCAGG + Intergenic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113085724 13:106567806-106567828 CCGCACGCGCTCCTTGTCCCGGG + Exonic
1117424465 14:55580387-55580409 CCCCCCGCGCTCCCCGCCGCCGG - Intronic
1122301637 14:100734472-100734494 CAGCGCGCGCTTCTTGACACAGG - Exonic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1138135268 16:54515940-54515962 TCGCTCGGGCTCCTTGCCTCTGG - Intergenic
1141428156 16:83956919-83956941 CCGCGCCCTCTGCTGGCCGCAGG - Intronic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1142206515 16:88785438-88785460 CCGCGCACGCTCGGAGCCGCGGG - Intergenic
1142293259 16:89202097-89202119 CCGCCCGCCCTCCTCGGCGCTGG + Intergenic
1142854294 17:2721431-2721453 CCCCACGCGCTCCTGGCCCCTGG - Intergenic
1144724498 17:17495031-17495053 CCGCGCGCGCTCCCGGCCTGGGG + Exonic
1145265238 17:21376767-21376789 CCGGGGGCGCTCCATGCCGAGGG - Exonic
1145962871 17:28897579-28897601 CCGAGGGCCCTCCGTGCCGCCGG - Exonic
1147608309 17:41786447-41786469 CCCAGCGCGCCCCCTGCCGCCGG + Intronic
1147879825 17:43646299-43646321 CCGCGCCCCCTCCTGGCAGCGGG + Intronic
1149994763 17:61400585-61400607 CCGCCCGCGCGCCTTCCAGCCGG - Intronic
1151736062 17:75941048-75941070 CCTCGCGCCCGCCTTTCCGCGGG - Intronic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG + Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1162315539 19:9936273-9936295 CCGCGCCCGCACCTGCCCGCCGG + Intronic
1163830902 19:19546757-19546779 CCGCCCGTGCTTCTTGCCCCCGG - Intergenic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1164647984 19:29873237-29873259 CCCAGCGCGGGCCTTGCCGCGGG + Intergenic
1165079997 19:33301681-33301703 GCGCCCGCGCTCGGTGCCGCCGG - Exonic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1166809587 19:45507506-45507528 CAGCGCGCACCCCTTGCCGGTGG - Exonic
927652351 2:24920226-24920248 CCACGCGCGCTCCAGGCCCCGGG + Intergenic
927971335 2:27307721-27307743 CCGCGCGCTCCTCTTGCTGCTGG - Exonic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929787819 2:45004774-45004796 CCGCGCGTACTCCTTGGCGGTGG - Intergenic
932316856 2:70790408-70790430 CCGCTCACGCTCCTTGGCGTTGG + Exonic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
946366762 2:219253523-219253545 CCGCGCCCCGTCCTTTCCGCGGG - Intronic
1170756914 20:19212853-19212875 ACGCGCGCGGTCCTCGTCGCCGG - Exonic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1174736924 20:52973381-52973403 TCGCCCGCCCTCCTTGCCCCTGG + Intronic
1175172851 20:57092227-57092249 CCCCGCACGCTTCTTGCCACCGG + Intergenic
1176221029 20:63969524-63969546 CCGCGCCCGCTCCCGGCCCCAGG - Intronic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176583227 21:8550121-8550143 CCGCCCGAGCTTTTTGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1184697955 22:46150369-46150391 CCGCGCGCCCTCCGGGCCCCGGG - Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
964622590 3:158732220-158732242 CCGCGCGCGCCGCCTGCTGCAGG + Exonic
968081552 3:195849852-195849874 CTGCGCGCGCCCCCTGCCGGCGG - Intergenic
968457164 4:705736-705758 CCGCCCACGCCCCTTGCCGCGGG + Intronic
995224887 5:109690531-109690553 CCGCGAGGGCTCCTTCCCTCAGG + Exonic
1002281111 5:178130724-178130746 CCGCGACCGCTCCTCGCCGGCGG - Intergenic
1002777442 6:341108-341130 CTGCCCGCGGTCCTTGCAGCAGG - Intronic
1014944052 6:127475953-127475975 CCGCGCGCTGTCGTGGCCGCCGG + Exonic
1015910202 6:138161920-138161942 TCACGCCCGCTCCATGCCGCGGG - Exonic
1035201319 7:157268634-157268656 CCGCTCGCCCTCCTTTCCCCTGG + Exonic
1035476123 7:159145100-159145122 CCGCGCCCTCTCCTCGCCCCTGG + Intergenic
1035580486 8:737055-737077 CCGAGGGCGCTCCTTGCGTCCGG + Intronic
1036665306 8:10733543-10733565 CCGCGCGTGCTCCACGCAGCCGG + Intronic
1042965738 8:74350344-74350366 CCGCGCGCCCTCCTTCCGGCAGG + Intronic
1044963906 8:97557014-97557036 CCGCCAGCGCTGCTGGCCGCGGG + Intergenic
1047499327 8:125429974-125429996 CGGCGCGCGCGCCCTCCCGCAGG - Intergenic
1048980869 8:139702995-139703017 CCGCGCCGGCTCCTTGCTGGCGG - Exonic
1049807573 8:144547898-144547920 CCGCACGTACTCCTTGCCGGCGG + Exonic
1049905667 9:214640-214662 CCGCCCGCGCTCCCTTCGGCCGG + Exonic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1060897003 9:127224854-127224876 CCCCGCGGGGTTCTTGCCGCCGG - Intronic
1061664145 9:132150509-132150531 CTGTGCGCCCTCCCTGCCGCCGG + Intergenic
1061988720 9:134145770-134145792 CCTCGCGCCCTCCTTGCACCCGG + Intronic
1062435577 9:136545408-136545430 CCGCGCGTGGGGCTTGCCGCCGG - Intronic
1062696504 9:137878551-137878573 CCGTGCGCGCGCCTGGCTGCAGG + Intronic
1062718623 9:138023441-138023463 CCGCGCTCGCTCCGCGCCTCCGG - Exonic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1199699625 X:150365545-150365567 CAGCGGGCGCCCCTCGCCGCCGG + Intronic