ID: 1163851932

View in Genome Browser
Species Human (GRCh38)
Location 19:19669128-19669150
Sequence ACACCCGGGGTCCCGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 8, 3: 19, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163851932_1163851939 -7 Left 1163851932 19:19669128-19669150 CCAGCCGCCGGGACCCCGGGTGT 0: 1
1: 0
2: 8
3: 19
4: 123
Right 1163851939 19:19669144-19669166 CGGGTGTCCTGTCCCGGCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 202
1163851932_1163851944 6 Left 1163851932 19:19669128-19669150 CCAGCCGCCGGGACCCCGGGTGT 0: 1
1: 0
2: 8
3: 19
4: 123
Right 1163851944 19:19669157-19669179 CCGGCCCCGGAGCCCTCTCAGGG 0: 1
1: 1
2: 6
3: 24
4: 152
1163851932_1163851942 5 Left 1163851932 19:19669128-19669150 CCAGCCGCCGGGACCCCGGGTGT 0: 1
1: 0
2: 8
3: 19
4: 123
Right 1163851942 19:19669156-19669178 CCCGGCCCCGGAGCCCTCTCAGG 0: 2
1: 8
2: 10
3: 44
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163851932 Original CRISPR ACACCCGGGGTCCCGGCGGC TGG (reversed) Intronic
900129970 1:1083216-1083238 ACACCCTGGGCCCCGGGGCCTGG + Intronic
900344480 1:2204589-2204611 GCTCCCGGGGGCTCGGCGGCGGG - Intronic
900506043 1:3030205-3030227 ACGCCTGTGGTCCCGGGGGCGGG + Intergenic
903282834 1:22259742-22259764 ACACCCGTGCTCCAGGCGGGAGG + Intergenic
905137038 1:35808084-35808106 GGACCCAGGGTCCCGGCGGGCGG - Intergenic
906524337 1:46485751-46485773 CTACCCGGGGGCCCGGCCGCGGG - Intergenic
916729525 1:167553637-167553659 CCGCGCGGGGTCGCGGCGGCCGG - Exonic
922801987 1:228368623-228368645 ACACCCAGAGGCCCGGGGGCAGG - Intronic
1063070397 10:2657160-2657182 GCAGCCTGGGTCCCTGCGGCAGG - Intergenic
1074772252 10:116742015-116742037 CCACCCGGCCACCCGGCGGCGGG + Intronic
1075911762 10:126131182-126131204 GCACCCAGGGTCCCCGAGGCAGG - Intronic
1076858815 10:133130020-133130042 ACTCCGGGGGTGGCGGCGGCAGG + Exonic
1076985265 11:231607-231629 ACAGCCAGGGTCCCAGCTGCAGG + Intronic
1077337620 11:2012483-2012505 ACAAACGGGTTCCCGGCGGCCGG - Intergenic
1083904854 11:65662831-65662853 ATGGCCGGGGTCCCGGGGGCGGG + Exonic
1084165383 11:67372865-67372887 ACGGCCGGGGAGCCGGCGGCAGG - Intronic
1088314929 11:108498114-108498136 ACGCGCGGGGACCCGGCCGCGGG + Intronic
1088920843 11:114258818-114258840 ACACCCGTGGTCCCATCGGCTGG - Intronic
1202820604 11_KI270721v1_random:67665-67687 ACAAACGGGTTCCCGGCGGCCGG - Intergenic
1096253785 12:50050914-50050936 CCACCCGGGGCCCCGGCGCTGGG - Intergenic
1096677136 12:53232004-53232026 AGCCCCGAGGTCCCGGCGTCGGG + Exonic
1101433262 12:104644501-104644523 ACACCTGGGCTCCCTGCAGCTGG + Intronic
1104829664 12:131741508-131741530 ACACCTGTGGTCCCAGCTGCTGG + Intronic
1104865275 12:131949941-131949963 GCATCCGGGGCCCCGGCGGGAGG - Intronic
1106558511 13:30829996-30830018 ACAGCCGGAGTCCCGGAGCCAGG - Intergenic
1106735928 13:32587172-32587194 GCGCGCGGGGACCCGGCGGCGGG - Intronic
1112319662 13:98395113-98395135 ACACCCGAGGCCTCTGCGGCGGG - Intronic
1113864428 13:113511927-113511949 ACACTCGGAGTCACGGAGGCCGG + Intronic
1113864445 13:113512000-113512022 ACACTCGGAGTCGCGGGGGCCGG + Intronic
1113864478 13:113512148-113512170 ACACTCGGAGTCGCGGGGGCCGG + Intronic
1113864495 13:113512221-113512243 ACACTCGGAGTCGCGGGGGCCGG + Intronic
1117157068 14:52951378-52951400 ACATCCGGGCTCTAGGCGGCGGG + Intronic
1117549091 14:56816732-56816754 AGACCCGGCGACCCGCCGGCAGG - Intergenic
1118925767 14:70188729-70188751 AGGCCCGGAGTCCCGGCCGCGGG + Exonic
1120958108 14:90100816-90100838 ACACCTGTGGTCCCAGCTGCTGG - Intronic
1121758560 14:96423761-96423783 GCGCTCGGGGTCCCGGTGGCCGG - Intronic
1122688931 14:103522577-103522599 GCGCCGGGGGGCCCGGCGGCGGG - Intronic
1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG + Intergenic
1123063747 14:105606073-105606095 GCACCCAGGGTCCCAGGGGCAGG - Intergenic
1124574549 15:30896224-30896246 GCACCCGGGGACGCGGAGGCGGG + Intergenic
1127158613 15:56155596-56155618 ACACACTGGGGCCCGTCGGCGGG + Intronic
1130614457 15:85391609-85391631 ACACCGGTGGTCCCAGCTGCTGG - Intronic
1132364986 15:101251071-101251093 GCACCCGGGATGCCGGCCGCCGG + Intronic
1132623448 16:879088-879110 GTACCCGGGGTTCCGGGGGCTGG + Intronic
1132856768 16:2048496-2048518 AGACCCAGGGTCCTGACGGCTGG + Intronic
1132874465 16:2130192-2130214 TCACCCGGGGTCCCTGAGCCGGG - Intronic
1134553410 16:15149025-15149047 TCACCCGGGGTCCCTGAGCCGGG - Intergenic
1136153093 16:28364963-28364985 ACACCCGGGGCGGCCGCGGCAGG - Intergenic
1136209990 16:28750310-28750332 ACACCCGGGGCGGCCGCGGCAGG + Intergenic
1136654335 16:31700857-31700879 GCGCCCGGGGTCCCAGCTGCCGG - Intergenic
1136656731 16:31713589-31713611 ACGCGCGGGGTCCCGGCTGCCGG - Intronic
1136672938 16:31874144-31874166 ACACGCGGGGTCCCGGCTGCCGG - Intronic
1142194012 16:88731290-88731312 ACACCCGTGGTCCCGTCTCCTGG - Intronic
1142849505 17:2697567-2697589 GCACCGGGGGTCCCCGCCGCTGG - Intronic
1143240421 17:5438959-5438981 ACAGCCGGGGTGCCGGCTGCAGG + Exonic
1143668890 17:8383072-8383094 ACTCTCGGGGTCCCCGCGGTCGG + Exonic
1147629107 17:41918703-41918725 TCGCCCGGGGTCCCGGCCGGTGG - Intronic
1148608017 17:48944759-48944781 AGACCCGGGGTCCCGGCAGCCGG - Exonic
1148786917 17:50150078-50150100 GCACCCGCCGTCCCGGCTGCAGG - Exonic
1150790469 17:68197686-68197708 GCACACTGGGTCCCGGAGGCGGG - Intergenic
1151408794 17:73907172-73907194 TCACCTGGGGTCCCGGCGACGGG + Intergenic
1157338128 18:46756319-46756341 CCACCCGGGGGCTCGCCGGCCGG + Intronic
1159831115 18:73279245-73279267 ACACCTGTGGTCCCGGCTACTGG + Intergenic
1160874721 19:1291638-1291660 ACCCACGGGGTCCTGGCTGCCGG + Intronic
1162597441 19:11640066-11640088 ACGCCCGGAGTCCTGGCTGCAGG - Intergenic
1162615741 19:11798900-11798922 ACGCCCGGGGTCCCAGCTGCGGG - Intronic
1162617603 19:11814592-11814614 AGGCCCGGGGTCCCGGCTGCCGG - Intronic
1162621737 19:11849083-11849105 ACGCCCGGAGTCCCGGCTGCCGG - Intronic
1162646266 19:12052607-12052629 ACGCCCGGGGTCCCGGCTGCCGG + Intronic
1162651576 19:12092590-12092612 ATGCCCCGGGTCCCGGCTGCCGG - Intronic
1162654437 19:12117773-12117795 ACGCCCAAGGTCCCGGCTGCTGG - Intronic
1162657158 19:12139989-12140011 ACGCCCGGGGTCCCGGCTGCCGG + Intronic
1162659210 19:12156364-12156386 ACGCCTGGGGTCCCGGCTGCCGG + Intronic
1162660299 19:12163376-12163398 ACGCCCGGGGTCCCGGCTGCCGG - Intronic
1162668708 19:12237278-12237300 ATGCCCGGGGTCCCGGCTGCTGG + Intronic
1162672069 19:12266086-12266108 ACGCCCGGGGTCCCGACTGCCGG + Intronic
1162675342 19:12294499-12294521 ACGCCCGGGGTCCCGGCTGCCGG + Intronic
1162683758 19:12365332-12365354 ACGCCCGGGGTCCCGGCTGCCGG + Intronic
1162697002 19:12484459-12484481 ACGTCCGGGGTCCCGGCTGCCGG + Intronic
1162698472 19:12495721-12495743 ACTCCCGGGATCCTGGCTGCCGG - Intronic
1162700818 19:12513549-12513571 ACGCCCGGGGTCCCGGCTGCCGG + Intronic
1162818208 19:13208595-13208617 CCACCGGGGTGCCCGGCGGCCGG - Intronic
1163210524 19:15836740-15836762 ACTCCCGGAGTCCCAGCTGCCGG + Intergenic
1163851932 19:19669128-19669150 ACACCCGGGGTCCCGGCGGCTGG - Intronic
1163893689 19:20039145-20039167 CCGCCCAGGGTCCCGGCTGCTGG + Intronic
1164023402 19:21329018-21329040 ACGCCCGGGGGCCCGGCTGTCGG + Intronic
1164030301 19:21397440-21397462 ACGCCCGGGGCCCCGGCTGTTGG - Intronic
1164208287 19:23075542-23075564 ACGCTGGGGGTCCCGGCCGCGGG - Intronic
1167638447 19:50667942-50667964 GCACCAGGGGTCGCGGGGGCAGG + Exonic
926914269 2:17878260-17878282 TCCCCCGCGGCCCCGGCGGCTGG - Intronic
935301582 2:101697804-101697826 ACGCCCGGGGGCCTGACGGCCGG + Intronic
936045900 2:109187873-109187895 ACACCCACGGTGACGGCGGCAGG - Intronic
937901737 2:127025100-127025122 CATCCCGGGGTCCCGGCTGCTGG - Intergenic
946024520 2:216664022-216664044 ACACTCGGGGTCCCCCCGGATGG - Exonic
946622455 2:221573606-221573628 GGAGCCTGGGTCCCGGCGGCCGG + Intronic
1172118535 20:32584924-32584946 GCACCGGGCGGCCCGGCGGCCGG - Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1176077820 20:63256477-63256499 GCGCCTGGGGTCCCCGCGGCTGG - Intronic
1176366943 21:6039124-6039146 ACCCCCGGGGCCCCTGCAGCAGG + Intergenic
1179504126 21:41828783-41828805 ACACCAGGGATCCTGGGGGCAGG - Intronic
1179756575 21:43499422-43499444 ACCCCCGGGGCCCCTGCAGCAGG - Intergenic
1180052986 21:45341399-45341421 CCACCCGGGGTCTCTGTGGCTGG + Intergenic
1183441506 22:37825473-37825495 ACAGGCGGAGTCCAGGCGGCAGG - Exonic
1184642789 22:45881060-45881082 CCAGCCGGGGTCCTGGGGGCAGG + Intergenic
1184859627 22:47165755-47165777 ACCCCCGGGGTCCGGGGGGCAGG - Intronic
954791402 3:53135984-53136006 AGACCCTGGGTCCCAGGGGCTGG - Intergenic
957048828 3:75396321-75396343 GCCCCCGGGGTCCGCGCGGCTGG + Intergenic
960465974 3:117997120-117997142 CCACCCCGGAGCCCGGCGGCAGG + Intergenic
960586122 3:119322870-119322892 GCACCCGGGACCCCCGCGGCCGG - Intronic
962804188 3:138915531-138915553 ACAGCCGCGCCCCCGGCGGCAGG + Intergenic
963852341 3:150221392-150221414 AGCCCCGGGGTCTCGGCGGCCGG + Intergenic
966350148 3:179024849-179024871 AAACCTGGGGGCCCGGGGGCGGG - Exonic
967055454 3:185825481-185825503 CCGCCCGGGGTTCCGGCGCCCGG - Intergenic
968309024 3:197667519-197667541 ACACCCAGGGTCCAGGAGGCGGG + Intergenic
969498784 4:7540778-7540800 ACACCCGGGGTGCGGGGGGCAGG - Intronic
971272157 4:25160210-25160232 AGCCCCGGGGTCGCGGCGGCTGG + Intronic
972382459 4:38532020-38532042 ACACACCGGGTCCCGTCGGGGGG - Intergenic
974360719 4:60875889-60875911 ACACCTGTGGTCCCAGCTGCTGG - Intergenic
983940107 4:173529015-173529037 AGGCCCGGGGGCCCGGCGCCCGG + Exonic
985068966 4:186149950-186149972 ACACCCGGAGAGCCGGCTGCAGG - Intronic
985540144 5:484029-484051 ACCCCCGGTGTCCATGCGGCTGG + Intronic
992484313 5:77180533-77180555 ACACCTGGGTACCCGGCCGCTGG + Intergenic
992795962 5:80255644-80255666 CCACGCGGAGTCCCGGAGGCCGG + Intronic
997470620 5:134115108-134115130 ATCCCGGGGGTCCCGGGGGCCGG + Exonic
999943081 5:156565705-156565727 ACACACGGGGTCCTGTCGGTGGG - Intronic
1001553029 5:172617993-172618015 ACGCCCCGGGTCCCGGTTGCTGG - Intergenic
1001959558 5:175872002-175872024 ACGGCCGGGGTCCCGGAGCCAGG + Intronic
1004356519 6:14933963-14933985 ACACCCCAGGTCCCTTCGGCAGG + Intergenic
1011672444 6:89695907-89695929 GCTCCCAGAGTCCCGGCGGCAGG - Exonic
1013236323 6:108200241-108200263 ACCCCCGGGGCCCGGGAGGCTGG + Intergenic
1015525938 6:134175434-134175456 GGGGCCGGGGTCCCGGCGGCGGG - Intronic
1018131041 6:160732819-160732841 ACACTTGGGGTACCGGGGGCTGG - Intronic
1018745346 6:166757583-166757605 ACTCCCCAGGTCCCGGGGGCCGG + Intronic
1019187461 6:170229134-170229156 ACACCCGGGCTGCAGACGGCCGG + Intergenic
1019527449 7:1487149-1487171 TCACCCGGGGGGCTGGCGGCAGG - Intronic
1019716577 7:2542068-2542090 AGAACCTGGGTCCCTGCGGCTGG - Intronic
1025265160 7:57450501-57450523 ACTCCCAGGGTCCCAGCCGCTGG - Intronic
1025719763 7:63999173-63999195 ACTCCCAGGGTCCCAGCCGCTGG - Intergenic
1025742294 7:64207415-64207437 ACTCCCAGGGTCCCAGCCGCTGG - Intronic
1026798660 7:73382908-73382930 ACACCTGTGGTCCCAGCAGCAGG + Intergenic
1034147232 7:148884119-148884141 ACTCCCGGAGCCCCGCCGGCCGG + Intronic
1034498200 7:151434190-151434212 CCACCTGGGGTCCCGATGGCTGG + Intronic
1035424585 7:158760580-158760602 ACACCTGTGGTCCCAGCTGCTGG - Intronic
1036020739 8:4842591-4842613 GCACCCGGGTTCCCTGCAGCAGG - Intronic
1036578999 8:10055045-10055067 GTGCCCTGGGTCCCGGCGGCCGG - Intronic
1049748705 8:144273679-144273701 TCCCCGGGGGTCCCAGCGGCTGG + Intronic
1060943522 9:127556948-127556970 ACACCTGGGGTCCCAGCTACTGG + Intronic
1062176121 9:135164060-135164082 ACCCCCAAGGTCCCGGCGGCAGG - Intergenic
1186085272 X:5982729-5982751 ACACCCGTGGTCCCAGCTACTGG + Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1200986112 Y:9304557-9304579 TCATCCGGGGTACCGGCAGCAGG + Intergenic