ID: 1163852885

View in Genome Browser
Species Human (GRCh38)
Location 19:19675883-19675905
Sequence CCCACCTTGTTCCCTACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163852885_1163852892 13 Left 1163852885 19:19675883-19675905 CCTGTAGTAGGGAACAAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1163852892 19:19675919-19675941 CCTGGGAGGTTAAGACTGCAGGG 0: 2
1: 3
2: 82
3: 264
4: 1114
1163852885_1163852889 -1 Left 1163852885 19:19675883-19675905 CCTGTAGTAGGGAACAAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1163852889 19:19675905-19675927 GATGATCACTTGAGCCTGGGAGG 0: 30
1: 2719
2: 9317
3: 43455
4: 95214
1163852885_1163852890 12 Left 1163852885 19:19675883-19675905 CCTGTAGTAGGGAACAAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1163852890 19:19675918-19675940 GCCTGGGAGGTTAAGACTGCAGG 0: 2
1: 2
2: 69
3: 241
4: 796
1163852885_1163852887 -5 Left 1163852885 19:19675883-19675905 CCTGTAGTAGGGAACAAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1163852887 19:19675901-19675923 GTGGGATGATCACTTGAGCCTGG 0: 34
1: 3263
2: 9058
3: 16621
4: 25649
1163852885_1163852893 14 Left 1163852885 19:19675883-19675905 CCTGTAGTAGGGAACAAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1163852893 19:19675920-19675942 CTGGGAGGTTAAGACTGCAGGGG 0: 2
1: 6
2: 104
3: 435
4: 1471
1163852885_1163852888 -4 Left 1163852885 19:19675883-19675905 CCTGTAGTAGGGAACAAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1163852888 19:19675902-19675924 TGGGATGATCACTTGAGCCTGGG 0: 40
1: 3510
2: 17794
3: 42270
4: 79943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163852885 Original CRISPR CCCACCTTGTTCCCTACTAC AGG (reversed) Intronic
901063309 1:6483838-6483860 CCCACCTTGTCCCCTCTTCCTGG + Intronic
903812455 1:26042429-26042451 CCCACCCTTTTCCCTAGAACTGG + Intronic
907323097 1:53618045-53618067 CCCACCTTGTGCCCCAGCACAGG - Intronic
908531148 1:65035679-65035701 CCCACCCTGTTCCCTTCTTTGGG + Intergenic
912707589 1:111926519-111926541 CTCACCTTGCACCCTTCTACGGG - Intronic
915595665 1:156895073-156895095 CCCACCATGTTCCCCACTGCAGG + Intronic
918022009 1:180703235-180703257 CCCACCCTGATCACTACTGCTGG - Intronic
919181396 1:194087232-194087254 CCCACCTTGTACCCTATTTCTGG + Intergenic
920136008 1:203769894-203769916 CCCTTCTTGTTCCCTACTCGTGG - Intronic
920212058 1:204335432-204335454 CCCTCCCTGTCCCCTACTCCAGG - Intronic
921446308 1:215250870-215250892 CCCACCCTGTTTCCTTCTAGAGG + Intergenic
922252695 1:223864352-223864374 CCCACACTGTGCCCTTCTACGGG - Intergenic
1069721671 10:70553786-70553808 CCCACCTTGAGCCCTGCTGCAGG + Intronic
1072719744 10:97773079-97773101 CCCACTGTGTTCCCTACCATGGG - Intergenic
1078446237 11:11407119-11407141 CCCAGCTTGTTCCCAAGTCCTGG - Intronic
1081209101 11:40309927-40309949 CCCATCTTCTTCCCTCCTGCTGG + Intronic
1081566864 11:44265645-44265667 CCCTCCATCTTCCCTGCTACTGG - Intronic
1090428218 11:126625031-126625053 CCCACCCTGTTCCCTGAAACAGG - Intronic
1091043524 11:132304669-132304691 CCCACCTTTTTCTCTACTAGAGG - Intronic
1104044213 12:125150317-125150339 CACCCCTTGGTCCCAACTACAGG + Intergenic
1107572788 13:41680976-41680998 CCCAACTAGTTCCCAACTCCGGG + Intronic
1124025296 15:25960028-25960050 CTCACCCTGTTCCCTACTCAGGG + Intergenic
1124378118 15:29141442-29141464 CCCACCTTGTTCCCGATGGCAGG - Intronic
1141625843 16:85260706-85260728 CCCCCCGTGCTCCCTACTCCAGG + Intergenic
1143082047 17:4389027-4389049 GCCACCTTGTTCCAAAGTACTGG - Intergenic
1144832456 17:18139407-18139429 CCCACCATTCTCCCTACTCCTGG - Intronic
1146586868 17:34090284-34090306 CTCAACTTGTTCTCTCCTACAGG - Intronic
1146686228 17:34843296-34843318 TCCACCTTGTTCTCTCTTACTGG + Intergenic
1147256454 17:39184974-39184996 CCCACCCTGATCCCTACATCTGG - Intronic
1155064124 18:22254292-22254314 CCCTCCCTGTTCTCTCCTACGGG + Intergenic
1159982280 18:74797951-74797973 CTCACCTTGATCCCTCCTGCTGG - Intronic
1160389434 18:78518939-78518961 CCCACCTTGCTCCTTTCTCCCGG + Intergenic
1161374646 19:3933301-3933323 CCCACCCTCTTCCCTCCTCCTGG - Intronic
1162003035 19:7760156-7760178 CTCACTTTGTTCACCACTACTGG - Intergenic
1163852885 19:19675883-19675905 CCCACCTTGTTCCCTACTACAGG - Intronic
1167722421 19:51187553-51187575 CCCACCATGTTTCCTATTAAAGG - Intergenic
925287913 2:2727727-2727749 CCCACCTGGCTCCCTCCTCCAGG - Intergenic
925591205 2:5511789-5511811 CCCAGATTGTTCCCAACTACAGG + Intergenic
930155612 2:48104810-48104832 GCCACCTTGTTTCCAACTCCTGG + Intergenic
930597404 2:53405238-53405260 CCTACCTTTTTCCTTACTCCTGG + Intergenic
932814740 2:74852623-74852645 CCCAGCTTGTTTCCAACTCCTGG - Intronic
935353864 2:102179973-102179995 CCCACCTGCTTCCCCACAACAGG - Intergenic
937272477 2:120661875-120661897 CCCACCTTGTTCTCTGCCCCAGG + Intergenic
939908300 2:147946489-147946511 CCCACATTGTCCCCTTTTACTGG - Intronic
941592153 2:167433093-167433115 CCCTCCTTTTTCCCAACTCCTGG + Intergenic
945806104 2:214491591-214491613 TTCACCTTGCTCCCTAATACGGG - Intronic
946239545 2:218345269-218345291 CCCTCCTCCTTCCCTACTCCTGG + Exonic
1170699575 20:18691844-18691866 CCCACCTTGTTGCCTGCATCTGG + Intronic
1179389581 21:40975434-40975456 CCCAGCTCTTTCCCTCCTACAGG - Intergenic
1182904230 22:33921783-33921805 CCCACCCTGGTCCCTAGAACTGG - Intronic
949945253 3:9184932-9184954 CCCACCTTGTTCCCAAGCCCTGG + Intronic
951527702 3:23669768-23669790 CCCACCTTCTTCACTGCAACAGG - Intergenic
951720551 3:25693223-25693245 CCCACCTTCTACCCTCCAACAGG + Intergenic
953039103 3:39239002-39239024 CCCACCTTTCTCCCTCCTATAGG + Intergenic
953119084 3:40022204-40022226 GCCACCTTCGTCCCTAGTACAGG - Intronic
954623114 3:52006812-52006834 CCCAGCCTGTTCCCTGCTGCAGG - Intergenic
959847750 3:111054305-111054327 CACACCTTGGTCCCAGCTACTGG + Intergenic
959977356 3:112475493-112475515 CCCAACTTGATCCCTAGAACAGG + Intronic
962726177 3:138229597-138229619 TCACCCTTGTTCCCTATTACTGG + Intronic
972461894 4:39311910-39311932 CCCACCTTCTTCCCTGCTGATGG + Intronic
974316844 4:60293725-60293747 CCCACCTTGTACCCTCTGACAGG - Intergenic
977726187 4:100299626-100299648 CACTCCTTGCTCTCTACTACAGG - Intergenic
980706798 4:136507751-136507773 CCCACCTTGTTTCCAATCACTGG - Intergenic
980873180 4:138633307-138633329 TCCACCTGGTTCATTACTACAGG + Intergenic
981588266 4:146328031-146328053 CCCACCCTGCTCCCTGCCACTGG + Intronic
984952895 4:185019826-185019848 CCCACCTTTTTCCCTTCCCCGGG - Exonic
989164368 5:38420211-38420233 TCCACCTTGTTCACTCCTATAGG + Intronic
989375516 5:40756153-40756175 CTCACCTTGTTCCCCACTGACGG - Intergenic
990090151 5:52034952-52034974 CTTGCCTTGTTCCCAACTACTGG - Intronic
995584087 5:113628857-113628879 CCCTCCCTGTTCCCAATTACAGG - Intergenic
997638689 5:135434527-135434549 CCCAGCTTGTGCCCTTCTGCAGG - Intergenic
999647390 5:153731735-153731757 ATCACCCTGTTCCCCACTACAGG - Intronic
1004333498 6:14742763-14742785 CCCATCTTGTTGCCTAGAACTGG - Intergenic
1004881479 6:20012753-20012775 CCTGCCTTGTGCCATACTACTGG + Intergenic
1006358497 6:33574355-33574377 CCCAGGTTGTTCCCAAATACAGG - Intronic
1007628344 6:43259178-43259200 CCCACCTTGTCCCCCACCCCGGG + Exonic
1017611264 6:156188812-156188834 CCCACCTTCTTCCCCTCTCCTGG - Intergenic
1022623405 7:32008485-32008507 TCCACCTTGGTCCCTACTACTGG + Intronic
1026799639 7:73391590-73391612 CTCACCTTGTCCCCAGCTACTGG - Intergenic
1034202429 7:149290888-149290910 CCCACCTTCTTCCCCACTCTGGG - Intronic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1037595785 8:20353115-20353137 TCCACCTTGTTCCCTGATAGTGG + Intergenic
1039630138 8:39102208-39102230 CCCATCTGGTTTCCTACTGCTGG - Intronic
1040401407 8:47053383-47053405 CCCACCTCCTTCCGTCCTACAGG - Intergenic
1040860961 8:51999003-51999025 CCAGCCTTGGTCCCTACTTCAGG - Intergenic
1041308746 8:56491956-56491978 CCCACCTTGTTCTTTACTTCTGG + Intergenic
1042334977 8:67620497-67620519 CCCTCCTTCTTCCCTTCTAGAGG + Intronic
1044262951 8:90148880-90148902 GCCACCTTGTGCCCTGCTCCTGG + Intergenic
1045476459 8:102556890-102556912 CCCACCTGGTTCCCTGATAGAGG + Intronic
1045903704 8:107316542-107316564 CCCATCTGGTCCCCTACTCCAGG + Intronic
1046849453 8:118955737-118955759 CCCACCTTGCTTCCTCCCACTGG - Intergenic
1049327545 8:142031134-142031156 CCCAGCTTGTTCCCTAGAAGAGG + Intergenic
1050001024 9:1077054-1077076 CCAATCTTGTTCCCTCCTAGAGG - Intergenic
1050122768 9:2324945-2324967 CCCATCTTGTTCCCTGCTGATGG - Intergenic
1053195885 9:36118244-36118266 CCCTACTTGTTCCCTTCTCCTGG + Intronic
1055818147 9:80231715-80231737 CCCACCTTGGTCTCTAATCCAGG + Intergenic
1055875393 9:80935808-80935830 ACCACCATGTTCCCTCCTTCAGG + Intergenic
1058717478 9:107735972-107735994 CCCACCTAGTTACCTAATCCTGG + Intergenic
1059363140 9:113763569-113763591 TTCACCTTGTTCCCTCCTAGAGG - Intergenic
1060039600 9:120288500-120288522 CTTCCCTTGTACCCTACTACGGG + Intergenic
1060944651 9:127562799-127562821 CCCAGCTTTTTCCCTAATGCTGG - Intronic
1188101225 X:26090453-26090475 CCCACCTTCCACCCTCCTACAGG - Intergenic
1188671666 X:32888840-32888862 ACCACATTGTTCCCAATTACAGG - Intronic