ID: 1163855159 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:19695926-19695948 |
| Sequence | AATTAAAAGCATAATGAGGT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163855159_1163855161 | 3 | Left | 1163855159 | 19:19695926-19695948 | CCGACCTCATTATGCTTTTAATT | No data | ||
| Right | 1163855161 | 19:19695952-19695974 | ACTTCTCTTATGATCTCTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163855159 | Original CRISPR | AATTAAAAGCATAATGAGGT CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||