ID: 1163855159

View in Genome Browser
Species Human (GRCh38)
Location 19:19695926-19695948
Sequence AATTAAAAGCATAATGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163855159_1163855161 3 Left 1163855159 19:19695926-19695948 CCGACCTCATTATGCTTTTAATT No data
Right 1163855161 19:19695952-19695974 ACTTCTCTTATGATCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163855159 Original CRISPR AATTAAAAGCATAATGAGGT CGG (reversed) Intergenic
No off target data available for this crispr