ID: 1163860918

View in Genome Browser
Species Human (GRCh38)
Location 19:19742490-19742512
Sequence ACTAGGGCCCTGTAGAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163860918_1163860930 14 Left 1163860918 19:19742490-19742512 CCCATGCTCTACAGGGCCCTAGT No data
Right 1163860930 19:19742527-19742549 CCACACACCCCTCTTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163860918 Original CRISPR ACTAGGGCCCTGTAGAGCAT GGG (reversed) Intergenic
No off target data available for this crispr