ID: 1163862426

View in Genome Browser
Species Human (GRCh38)
Location 19:19749285-19749307
Sequence CCGTCCAGGCATGGAGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163862413_1163862426 19 Left 1163862413 19:19749243-19749265 CCAGATCCAAGAGTTCAGCCAGG No data
Right 1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG No data
1163862415_1163862426 13 Left 1163862415 19:19749249-19749271 CCAAGAGTTCAGCCAGGTGCAGG No data
Right 1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG No data
1163862420_1163862426 1 Left 1163862420 19:19749261-19749283 CCAGGTGCAGGTGTGGGAATGGT No data
Right 1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG No data
1163862412_1163862426 25 Left 1163862412 19:19749237-19749259 CCAGAGCCAGATCCAAGAGTTCA No data
Right 1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG No data
1163862411_1163862426 30 Left 1163862411 19:19749232-19749254 CCTGGCCAGAGCCAGATCCAAGA No data
Right 1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163862426 Original CRISPR CCGTCCAGGCATGGAGTGGA CGG Intergenic
No off target data available for this crispr