ID: 1163862612

View in Genome Browser
Species Human (GRCh38)
Location 19:19750116-19750138
Sequence CTGTGTAGGGTGGATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163862612_1163862618 -5 Left 1163862612 19:19750116-19750138 CCTTCCACATCCACCCTACACAG No data
Right 1163862618 19:19750134-19750156 CACAGCCCCAGGACCATCAGTGG No data
1163862612_1163862620 -3 Left 1163862612 19:19750116-19750138 CCTTCCACATCCACCCTACACAG No data
Right 1163862620 19:19750136-19750158 CAGCCCCAGGACCATCAGTGGGG No data
1163862612_1163862627 21 Left 1163862612 19:19750116-19750138 CCTTCCACATCCACCCTACACAG No data
Right 1163862627 19:19750160-19750182 CCAGCCCTGCAACCCCATCTTGG No data
1163862612_1163862619 -4 Left 1163862612 19:19750116-19750138 CCTTCCACATCCACCCTACACAG No data
Right 1163862619 19:19750135-19750157 ACAGCCCCAGGACCATCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163862612 Original CRISPR CTGTGTAGGGTGGATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr