ID: 1163865598

View in Genome Browser
Species Human (GRCh38)
Location 19:19770489-19770511
Sequence TATAGATTAACAGCATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2925
Summary {0: 464, 1: 169, 2: 591, 3: 458, 4: 1243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163865598_1163865609 29 Left 1163865598 19:19770489-19770511 CCTTGGGATGCTGTTAATCTATA 0: 464
1: 169
2: 591
3: 458
4: 1243
Right 1163865609 19:19770541-19770563 ACAGGTGCTGTGTCCACTAAGGG No data
1163865598_1163865604 11 Left 1163865598 19:19770489-19770511 CCTTGGGATGCTGTTAATCTATA 0: 464
1: 169
2: 591
3: 458
4: 1243
Right 1163865604 19:19770523-19770545 AACCCCGTGCTCTCTGAAACAGG No data
1163865598_1163865608 28 Left 1163865598 19:19770489-19770511 CCTTGGGATGCTGTTAATCTATA 0: 464
1: 169
2: 591
3: 458
4: 1243
Right 1163865608 19:19770540-19770562 AACAGGTGCTGTGTCCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163865598 Original CRISPR TATAGATTAACAGCATCCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr