ID: 1163865604

View in Genome Browser
Species Human (GRCh38)
Location 19:19770523-19770545
Sequence AACCCCGTGCTCTCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163865598_1163865604 11 Left 1163865598 19:19770489-19770511 CCTTGGGATGCTGTTAATCTATA 0: 464
1: 169
2: 591
3: 458
4: 1243
Right 1163865604 19:19770523-19770545 AACCCCGTGCTCTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163865604 Original CRISPR AACCCCGTGCTCTCTGAAAC AGG Intergenic
No off target data available for this crispr