ID: 1163882249

View in Genome Browser
Species Human (GRCh38)
Location 19:19935347-19935369
Sequence CTCTGAATTTGTAGTGATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 12, 2: 3, 3: 18, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163882249_1163882254 -2 Left 1163882249 19:19935347-19935369 CCCTCATCACTACAAATTCAGAG 0: 1
1: 12
2: 3
3: 18
4: 221
Right 1163882254 19:19935368-19935390 AGGGCATCTCATCACCCTAAGGG 0: 6
1: 3
2: 4
3: 14
4: 151
1163882249_1163882253 -3 Left 1163882249 19:19935347-19935369 CCCTCATCACTACAAATTCAGAG 0: 1
1: 12
2: 3
3: 18
4: 221
Right 1163882253 19:19935367-19935389 GAGGGCATCTCATCACCCTAAGG 0: 6
1: 5
2: 7
3: 21
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163882249 Original CRISPR CTCTGAATTTGTAGTGATGA GGG (reversed) Exonic
906229444 1:44148548-44148570 CTCAGAATTGGTAGGAATGAGGG - Intergenic
907825827 1:58015969-58015991 CTGTCATTTTGCAGTGATGAAGG + Intronic
913024520 1:114823714-114823736 CTGTTAATTTGTAGTAATCATGG - Intergenic
913646391 1:120859550-120859572 CTCTGAATTCTTAGTGTTGAGGG - Intergenic
914233331 1:145785259-145785281 TTCTGAATTTATATTAATGAAGG - Intronic
915606110 1:156952195-156952217 GTCTGATTCTGTAGTGATGAAGG - Intronic
916303521 1:163302781-163302803 TTCTGAATTTGGTGTGAGGAAGG - Intronic
919002589 1:191852671-191852693 CCATGAATTTGTGGTGATGCTGG - Intergenic
919329767 1:196156751-196156773 CTCTGAATCTGCTGTGATTATGG - Intergenic
922247401 1:223813808-223813830 CTCTGAGGTAGGAGTGATGATGG - Intronic
924167618 1:241301467-241301489 CCCTGAATATTTAGGGATGATGG + Intronic
1063625961 10:7690379-7690401 GTCTGAATTTGTAGTGTTGCAGG - Intergenic
1068348134 10:55811137-55811159 CTCTGAATTTGTTGTAATTCTGG - Intergenic
1068784234 10:60952912-60952934 CTTTGAATTTGTGGTTGTGAGGG - Intronic
1069242155 10:66156330-66156352 CTGTGATTTTGTTGTGATGTTGG + Intronic
1072982879 10:100114531-100114553 TGCTGAATTTGTAGAGATAATGG - Intergenic
1073065097 10:100753806-100753828 CTCTGATTCTGTTGTGATAAAGG + Intronic
1074175406 10:110995967-110995989 CTCTGAATGTTTAGAGATGGGGG - Intronic
1074752551 10:116600665-116600687 CTCTGAATTTGGAGTTGGGAAGG - Intronic
1074810263 10:117097903-117097925 ATCTGAATCTGTTGGGATGATGG - Intronic
1076076804 10:127539738-127539760 CTCTGAATTTGTTTTTAAGAAGG - Intergenic
1077979292 11:7283751-7283773 CTGTTAATTTGTAGTAATCATGG + Intronic
1080992646 11:37557981-37558003 CTGAGATTTTGGAGTGATGAAGG - Intergenic
1081285427 11:41263280-41263302 ATGTGATTTTATAGTGATGAGGG - Intronic
1084351237 11:68601309-68601331 CTCTGAGTTTGTGGGAATGAGGG + Intronic
1085989777 11:81827895-81827917 CTCTGTATTTTTAGTGGAGACGG + Intergenic
1086233962 11:84604749-84604771 CTTTGTCTTTGTAGTCATGATGG + Intronic
1087570363 11:99919676-99919698 CTTTCAAGTTGTGGTGATGAAGG - Intronic
1088584180 11:111346120-111346142 CTCTGAGTTTCTTGTGATCAAGG + Intergenic
1088743799 11:112787700-112787722 CTGTGAATTTGGAGCTATGATGG - Intergenic
1092180914 12:6446124-6446146 TTCTGAAATTGTAGCGAAGATGG - Intronic
1100631475 12:96393906-96393928 GTCTAAATTTGGAGTGATAAGGG + Intronic
1100821912 12:98439587-98439609 GCCAGAATTTGTAGTGGTGAGGG - Intergenic
1100828588 12:98497512-98497534 CTCTGAATTTGCTGTGATTCTGG + Intronic
1100978336 12:100144600-100144622 CTCTGAATCTGCTGTGATTATGG + Intergenic
1103766769 12:123285833-123285855 CTCTGTATTTTTAGTAAAGATGG - Intergenic
1105918260 13:24937583-24937605 CTCTGAATGTGTTGGGATTACGG + Intergenic
1106557521 13:30822929-30822951 GTCTGAATATGTGGTGAGGAAGG - Intergenic
1107335612 13:39351923-39351945 CTCTGAATCTGTTGTGATACAGG + Intronic
1107733665 13:43373942-43373964 CTCTGAGTTTCTAATGTTGAGGG - Intronic
1107824365 13:44314279-44314301 CTCTGAATTGGTTGTGATTCTGG - Intergenic
1108945000 13:56011264-56011286 CTCTAAATTTGAAGTGAGAAGGG - Intergenic
1110009045 13:70308304-70308326 CACTGACTTTGTAGTAATAACGG - Intergenic
1112601043 13:100856392-100856414 CTCAGGATTTATAATGATGAAGG - Intergenic
1112980340 13:105376824-105376846 CTCTGAATTGTAAATGATGATGG + Intergenic
1114763528 14:25344750-25344772 CTCTGAAGCTGTGGTGATGCTGG + Intergenic
1115637295 14:35302361-35302383 CACTAAATTTGTAGTGATTCTGG - Intronic
1116040491 14:39680429-39680451 CTCTGAATGTGCAGAGATGGTGG + Intergenic
1116234835 14:42266628-42266650 CTCTGAATTTGCTGTGATTCTGG - Intergenic
1116365354 14:44054476-44054498 CTCTAATTTTGTAGTTCTGAGGG - Intergenic
1116483391 14:45418110-45418132 CTCTGAATCTGCTGTGATGCTGG + Intergenic
1116491453 14:45508301-45508323 CTCTAAATTTGGAGTGCTTAAGG + Intergenic
1120011974 14:79426313-79426335 CTCTGACATTGGAGTGATGGAGG - Intronic
1123177955 14:106439831-106439853 CTCAGAATTTATTGTGATGGAGG - Intergenic
1124115209 15:26835256-26835278 CACTGAATCTGTAGTGAATATGG + Intronic
1124403004 15:29366626-29366648 TTCTGAAATTCTAGTGATGGAGG - Intronic
1125361809 15:38872584-38872606 CTCTGAATCTGTTGTGATTCTGG + Intergenic
1125700188 15:41675632-41675654 CTCTGAAATTGTTGGGATTACGG + Intronic
1128436835 15:67660493-67660515 CTCTGAAAGTGTACTGAAGATGG + Intronic
1128903934 15:71451005-71451027 CTCTGCATTTTTAGTGGAGACGG - Intronic
1130565578 15:84992196-84992218 CTCTGACCTGGAAGTGATGATGG + Intronic
1132193536 15:99891205-99891227 CAGTGGATTTGTAGGGATGAAGG - Intergenic
1136392949 16:29976876-29976898 CTCTGAAATCATAGTGATGGAGG + Intronic
1138153572 16:54682184-54682206 CCCTGCATTGTTAGTGATGATGG + Intergenic
1138510606 16:57506609-57506631 CTCTGAATTTATGATAATGAAGG + Intergenic
1138704263 16:58898316-58898338 TTCTGAATTTTTAGTGGAGATGG + Intergenic
1144381562 17:14703631-14703653 CTCTGAATCTGTTGTGATTCCGG - Intergenic
1145741774 17:27280843-27280865 TTCTGGATTTGCAGCGATGAGGG - Intergenic
1146818588 17:35965389-35965411 CACTGACTCTGTAGTGATGCTGG + Intergenic
1148714049 17:49702943-49702965 CTTTCGAGTTGTAGTGATGATGG + Exonic
1150197374 17:63314448-63314470 CACTGACTCTGTAGTGATGCTGG - Exonic
1151829181 17:76539695-76539717 CTCTGAATTTGCAGTGCACAAGG - Intronic
1153892084 18:9526656-9526678 CTTTGGAAATGTAGTGATGAGGG + Intronic
1154215989 18:12416486-12416508 TTCTGTTTTTGTAGAGATGAGGG + Intronic
1155002256 18:21698749-21698771 CTCTGTATTTTTAGTGTAGATGG + Intronic
1155844131 18:30684377-30684399 AACTGAATTTCTGGTGATGATGG + Intergenic
1157210038 18:45734514-45734536 CTCTGAATGTATAGTGGTGATGG + Intronic
1161953368 19:7479624-7479646 CTCTGGATTTGCAGTGAGCAGGG - Intronic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163873560 19:19846240-19846262 CTCTGAATTGGTAGTGGAGAGGG - Intergenic
1163877212 19:19882354-19882376 CTGTGAATTTTTAGTGAAGAGGG + Intronic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1163901640 19:20106820-20106842 CTCTGAATTGATAGTGAAGAGGG + Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165309304 19:35021039-35021061 CTCCGAAGTTGTAGTGATTTGGG - Intronic
1166591936 19:44007401-44007423 AACTGTATTTGTATTGATGATGG + Intronic
1167068164 19:47202739-47202761 CTCTGAATTTTTAGTAGAGACGG - Intronic
927044258 2:19261580-19261602 CTATGAACTTTGAGTGATGATGG + Intergenic
927732626 2:25488076-25488098 CTCTGAACTTCTAGGGGTGAGGG + Intronic
928342924 2:30461109-30461131 CTCTGAATTTGTAGCCAAGTTGG + Intronic
928504134 2:31931318-31931340 GTCTGAATTAGTAGAGATGTAGG - Intronic
929080453 2:38117205-38117227 CTCTAAATTTCCAGTTATGAGGG - Intergenic
929280956 2:40078026-40078048 CTCTGACTCTGTAGTGTTGTTGG + Intergenic
929735272 2:44541539-44541561 CACTGAATTTTTACTGTTGAAGG + Intronic
930282998 2:49393769-49393791 ACATGAATTTGGAGTGATGAAGG - Intergenic
930780312 2:55218510-55218532 CCATGAATGTATAGTGATGAGGG - Intronic
930961039 2:57261995-57262017 CTCTGAATCTGTAGTAGTTAAGG + Intergenic
934151733 2:89153999-89154021 CTCAGGCTGTGTAGTGATGAAGG - Intergenic
934215527 2:90027907-90027929 CTCAGGCTGTGTAGTGATGAAGG + Intergenic
935423131 2:102891494-102891516 CTCTGAATTAGAAGTCATAAAGG + Intergenic
935977987 2:108598148-108598170 CGCTGCAGTTGTAGGGATGAGGG - Intronic
936135603 2:109890742-109890764 CGCTGCAGTTGTAGGGATGAGGG - Intergenic
936209094 2:110480743-110480765 CGCTGCAGTTGTAGGGATGAGGG + Intergenic
937730186 2:125221447-125221469 CTGAGAATTTGTGGTGATGGTGG + Intergenic
941128456 2:161616333-161616355 CTATGAAGCTGTAGTGAGGAGGG - Intronic
941371502 2:164671139-164671161 CTGAGAATTGGGAGTGATGAAGG - Intronic
941775094 2:169384846-169384868 TTCTGATTTTTCAGTGATGAAGG + Intergenic
944429302 2:199616198-199616220 CTCTGAACTTGTACTCATTATGG + Intergenic
944537404 2:200724844-200724866 CTCTGTAATTGTGGTGCTGACGG - Intergenic
945187900 2:207158183-207158205 CCTTGAATTGGTAGTTATGATGG - Intronic
948973135 2:241444834-241444856 CACTGAATTTGAGGTGATGCGGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1173912362 20:46679735-46679757 TTTTGAATTTTTAGTGAAGACGG - Intronic
1175436760 20:58957913-58957935 CCACGAATTTGTAGTGATGCTGG - Intergenic
1177793947 21:25753072-25753094 CACTAAATATGTAATGATGATGG - Intronic
1179252194 21:39680440-39680462 CACTGAGTTTGTGGTGATGCTGG + Intergenic
1179435440 21:41359310-41359332 CTGTGAAGTTCTTGTGATGACGG + Intergenic
1182366615 22:29783458-29783480 TTCTGAATATGAAATGATGACGG - Intergenic
950093324 3:10312722-10312744 CTCTCCCTTTGTAGTCATGAGGG - Exonic
951105073 3:18732792-18732814 CTCTGAAGTTGTGGAGGTGAGGG + Intergenic
955106951 3:55907657-55907679 CGCTGAGTTTGGACTGATGAAGG + Intronic
955681931 3:61511183-61511205 CTCTGATTTTATAGTGATGATGG - Intergenic
956391077 3:68773185-68773207 CCCTGAATTTGTAGTCAAGTTGG - Intronic
957030276 3:75232728-75232750 CACTGAATTTGTAATTATAATGG + Intergenic
957264781 3:77949054-77949076 CCATGAAGTTGTAGAGATGAGGG - Intergenic
957646478 3:82937784-82937806 CTCTGAATTTAAATAGATGAAGG - Intergenic
957746636 3:84352028-84352050 CTCTGAATAAATAGGGATGACGG - Intergenic
957748830 3:84384407-84384429 CTCTGATTTAGTAGAGGTGATGG + Intergenic
958731308 3:97963298-97963320 CTCTTATTTTGTAGAGATGGTGG + Intronic
959579206 3:107967033-107967055 CTCTGAATTGGAAGTGCAGAGGG + Intergenic
959807123 3:110568725-110568747 CTCTGAATGTGAAGTCATGGAGG - Intergenic
960247749 3:115417996-115418018 CTCTGAATCTGCTGTGATCATGG - Intergenic
961228125 3:125272978-125273000 CTCTTAATTTGTGAGGATGAAGG - Intronic
961984090 3:131114004-131114026 CTGGGAATTTGGAGTGAGGAGGG + Intronic
962561839 3:136614287-136614309 TTGTCAATTGGTAGTGATGAAGG + Intronic
963157855 3:142118199-142118221 TTCTGAATTTGTAGTGATGATGG - Intronic
965062138 3:163797509-163797531 CTTTGTATTTTTAGTGAAGATGG + Intergenic
965119875 3:164540689-164540711 CACTGACGTTTTAGTGATGATGG - Intergenic
966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG + Intergenic
966610955 3:181867618-181867640 CTCTGGGTTTCTAGTCATGAGGG - Intergenic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
970090690 4:12404171-12404193 CTCTGAATTTACAGTGTGGAGGG - Intergenic
971342210 4:25780994-25781016 TTCTGTATTTTTAGTGATGAGGG + Intronic
971965218 4:33545615-33545637 TTCTGTATTTGTGGTGATGCTGG + Intergenic
971974674 4:33668513-33668535 CTCTGAATTTGACGTGATTCTGG + Intergenic
972537567 4:40012155-40012177 CCCTAAATATGTAGTGAAGATGG - Intergenic
974562590 4:63541145-63541167 CTCTGAAATTGTAGTGCAGCAGG + Intergenic
975092147 4:70416535-70416557 CTATGAGTTTGAACTGATGAAGG - Intergenic
976144693 4:82031191-82031213 CTCTCACTTTGTAGCGTTGATGG - Intronic
976232658 4:82861226-82861248 CTCTGAATTAGTACTGAACATGG - Intronic
978061092 4:104340125-104340147 CTATTAATTTGGAGTTATGAAGG + Intergenic
979511255 4:121556376-121556398 CACTGAATTTGAAGTGCTGGTGG - Intergenic
984473128 4:180202609-180202631 CTCTCAATATATAGAGATGATGG - Intergenic
985314349 4:188639077-188639099 CACTGAAGTTCTAATGATGAAGG - Intergenic
986508597 5:8478942-8478964 CTCTGAATGTGTTCTGATGCTGG + Intergenic
986980301 5:13439865-13439887 CAGAGAATTTGTAGTAATGAAGG + Intergenic
987028486 5:13952535-13952557 CTCTGAATTTGCGGTGATATTGG - Intergenic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
987678324 5:21104455-21104477 CACTGAACTTTTAGTGATGCTGG - Intergenic
993261933 5:85668761-85668783 CTCAGCATTTGTAGAGATAAGGG - Intergenic
993360881 5:86974885-86974907 CTGTGAATTTGTAGTGAATAAGG - Intergenic
993511524 5:88776991-88777013 GCCTGATTTTGTAGTCATGATGG + Intronic
993745731 5:91594508-91594530 CTCTGAATCTGTTGTGATTCTGG - Intergenic
993967604 5:94376533-94376555 CTCAGAATTTGTAGGGCTAAGGG - Intronic
994205039 5:97025111-97025133 TTTTTAATATGTAGTGATGAAGG + Intronic
994582584 5:101664416-101664438 CTCTGAATTTGCTGTGATTCTGG - Intergenic
994659486 5:102636493-102636515 CTCTGAAGTTGAAGCGATGCAGG - Intergenic
997759710 5:136433332-136433354 CTTTGAATATTTAGTGAGGATGG - Intergenic
998543306 5:143003954-143003976 CTCTGAATGTGTGGTGATTCTGG - Intronic
1000732953 5:164859168-164859190 CAATGAATTTGTAGAGTTGAGGG - Intergenic
1001671842 5:173480254-173480276 CTCTGGATTTGTACTTATGTAGG - Intergenic
1003397245 6:5763934-5763956 CTCTGACTTTGGACTGAGGATGG - Intronic
1003761258 6:9181107-9181129 CCCTGAATTTGTAGCCATGGCGG + Intergenic
1004209276 6:13621875-13621897 GTTTGAATTTATAGTGTTGATGG - Exonic
1004343377 6:14826904-14826926 CTTTGAATTTCTAGTGAGCAAGG + Intergenic
1005200475 6:23338999-23339021 GTTTGAATTTCTGGTGATGAGGG + Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1009924389 6:70102393-70102415 CTCTTGGTTTGTGGTGATGATGG - Intronic
1012168438 6:95988488-95988510 GTCTTAATTTGAAGGGATGAAGG - Intergenic
1015084577 6:129273522-129273544 CTCTGCATTTATAGTAATGTTGG - Intronic
1018926741 6:168212211-168212233 CCCTGAATTTGTGCTCATGACGG - Intergenic
1021198641 7:17700579-17700601 CTCTGACCCTGTAATGATGATGG + Intergenic
1021280950 7:18717599-18717621 CTCTGTATTTTTAGTGGAGATGG + Intronic
1021324661 7:19251864-19251886 CTCTTAATGTGTGGTGATTATGG + Intergenic
1024160857 7:46674037-46674059 CTATGACTTTTTGGTGATGATGG + Intronic
1024761582 7:52603330-52603352 CTCGAAATATGTAGTGGTGATGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1028881254 7:95882539-95882561 CTCTGAATAAGTAGTGATTTGGG + Intronic
1031202393 7:118704323-118704345 CTCTGAATTTGTTCTAATCAAGG + Intergenic
1031691197 7:124789981-124790003 CTCTGAATCTGCAGTGATTCTGG + Intronic
1031693918 7:124825581-124825603 CTCTGATTTAATAATGATGATGG + Intronic
1035105356 7:156437366-156437388 ATCTGAATTTATGATGATGAGGG + Intergenic
1037259980 8:16997722-16997744 CTCTGTATTTGTCATTATGATGG - Intronic
1038933256 8:32218921-32218943 TTCTGAATCTGTAGTTATTAAGG - Intronic
1040598358 8:48861361-48861383 CACTGAGTATGCAGTGATGACGG + Intergenic
1042328708 8:67555625-67555647 CTCTGAATTTGTAGTCAGCCAGG + Intronic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1043191460 8:77227826-77227848 CACTGAATTTGGAGTTGTGAAGG + Intergenic
1044371562 8:91418315-91418337 CTCTGAAGCTGTAGTGTAGATGG + Intergenic
1044387156 8:91602626-91602648 CTCTGAATCTGTTGTGATTCTGG + Intergenic
1045109314 8:98924962-98924984 CTCTGATTTTGAAATAATGAGGG + Intronic
1046578835 8:116066893-116066915 CTCTGAATTTGCTGTGATTCTGG + Intergenic
1046676055 8:117109922-117109944 CTCAGCATTTATAGTGATTAAGG + Intronic
1051701176 9:19825690-19825712 CTCTGAATTTGTTGTGGGGCAGG - Intergenic
1052682997 9:31718009-31718031 CACTGGTTTTATAGTGATGAAGG - Intergenic
1053631823 9:39949033-39949055 CTCTGAAATTGTTGGGATTACGG - Intergenic
1054212064 9:62301665-62301687 CTCTGAAATTGTTGGGATTACGG + Intergenic
1056281005 9:85041204-85041226 CTCTGTATTTTTAGGGGTGACGG - Intergenic
1056696277 9:88856739-88856761 CTCTGGATTGGTACTGAGGAGGG - Intergenic
1056908123 9:90672377-90672399 CTCTGAATCTGTTGTGATTCTGG - Intergenic
1057138128 9:92709458-92709480 CTATTAATTTGTGCTGATGAAGG + Intergenic
1058275285 9:103033536-103033558 CAGTAACTTTGTAGTGATGAAGG + Intergenic
1059910916 9:119043209-119043231 CTCTAAATTTGTGGTGAGGAGGG - Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1062492745 9:136815115-136815137 CTCTGAACCAGCAGTGATGAAGG - Intronic
1187115884 X:16350150-16350172 TTTTGTATTTGTAGTAATGATGG + Intergenic
1189474600 X:41340597-41340619 CTGAGAATATATAGTGATGAGGG + Intronic
1189807740 X:44752320-44752342 TTTTGAATTTTTAGTGAAGACGG - Intergenic
1190156078 X:47993418-47993440 CTCTGAATTTGTAGTCAACCAGG + Intronic
1193393247 X:80954525-80954547 CTCTGAATCTGCTGTGATTATGG - Intergenic
1194101070 X:89704702-89704724 CTCTGAATTTATAATGCTAAGGG + Intergenic
1194555072 X:95348069-95348091 CTCTGACTTTGCAGTTTTGAGGG + Intergenic
1195255208 X:103083102-103083124 CTCTGAAGTTGAGGTGGTGAAGG + Intronic
1196028762 X:111072705-111072727 AACTGAATTTGTAGGGATGGAGG + Intronic
1196455716 X:115890167-115890189 TTTTAAATTTATAGTGATGAAGG - Intergenic
1196828920 X:119761127-119761149 TTTTGTATTTGTAGTAATGATGG + Intergenic
1197178820 X:123512391-123512413 CTCTGATCTTTTAGTAATGAGGG + Intergenic
1197704146 X:129621978-129622000 CTCCAAATTTGTAGTAATCATGG - Intergenic
1200454024 Y:3365786-3365808 CTCTGAATTTATAATGCTAAGGG + Intergenic