ID: 1163882508

View in Genome Browser
Species Human (GRCh38)
Location 19:19938604-19938626
Sequence CTAACGTTTTTGGCCTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163882503_1163882508 19 Left 1163882503 19:19938562-19938584 CCCCGCTGATTTTTTGAATTTCT No data
Right 1163882508 19:19938604-19938626 CTAACGTTTTTGGCCTAATAAGG No data
1163882502_1163882508 27 Left 1163882502 19:19938554-19938576 CCAGGGCTCCCCGCTGATTTTTT No data
Right 1163882508 19:19938604-19938626 CTAACGTTTTTGGCCTAATAAGG No data
1163882504_1163882508 18 Left 1163882504 19:19938563-19938585 CCCGCTGATTTTTTGAATTTCTA No data
Right 1163882508 19:19938604-19938626 CTAACGTTTTTGGCCTAATAAGG No data
1163882505_1163882508 17 Left 1163882505 19:19938564-19938586 CCGCTGATTTTTTGAATTTCTAA No data
Right 1163882508 19:19938604-19938626 CTAACGTTTTTGGCCTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163882508 Original CRISPR CTAACGTTTTTGGCCTAATA AGG Intergenic
No off target data available for this crispr