ID: 1163884536

View in Genome Browser
Species Human (GRCh38)
Location 19:19954162-19954184
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 4, 1: 16, 2: 12, 3: 47, 4: 485}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163884536_1163884541 18 Left 1163884536 19:19954162-19954184 CCATGGCTGGGGTGAGCAGGCTG 0: 4
1: 16
2: 12
3: 47
4: 485
Right 1163884541 19:19954203-19954225 CTCCCCAGAAAAAAGTAACTGGG No data
1163884536_1163884540 17 Left 1163884536 19:19954162-19954184 CCATGGCTGGGGTGAGCAGGCTG 0: 4
1: 16
2: 12
3: 47
4: 485
Right 1163884540 19:19954202-19954224 ACTCCCCAGAAAAAAGTAACTGG No data
1163884536_1163884539 -8 Left 1163884536 19:19954162-19954184 CCATGGCTGGGGTGAGCAGGCTG 0: 4
1: 16
2: 12
3: 47
4: 485
Right 1163884539 19:19954177-19954199 GCAGGCTGGGACATCTGCAGTGG 0: 4
1: 14
2: 15
3: 41
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163884536 Original CRISPR CAGCCTGCTCACCCCAGCCA TGG (reversed) Intergenic
900179745 1:1305898-1305920 GAGCCTGGTCGCCCCAGCCCGGG - Intronic
900403676 1:2483236-2483258 GCGCCTGCTCACCCCAGGCCTGG - Intronic
900589135 1:3452049-3452071 CAGCCCGGCCCCCCCAGCCATGG + Intergenic
900799601 1:4729019-4729041 CCTCCTGCTCACTCCAGCCCTGG + Intronic
900943171 1:5814322-5814344 CAGCCTGCTGACCACAGCAGTGG + Intergenic
900958529 1:5904416-5904438 CAGCGTCCTCCCCCAAGCCAGGG - Intronic
901166435 1:7224972-7224994 CAGCCTCCTCATCTCAGTCAAGG - Intronic
901241783 1:7698519-7698541 CAGGCTGCTGACCCCAGGCCAGG + Intronic
901529983 1:9846757-9846779 CAGCCTCCCCACCCCAGGCTCGG + Intergenic
901954836 1:12776673-12776695 CAGCCTGGCCACCCCAGCTGAGG + Intronic
902216890 1:14939964-14939986 TAGCCTGATCATCCCACCCAGGG + Intronic
902292554 1:15444860-15444882 GAGCCTGCTGGGCCCAGCCAGGG - Intronic
902742485 1:18448583-18448605 CAGGCTGCTTAGGCCAGCCAGGG + Intergenic
903266433 1:22160760-22160782 ATGCCTGCCCACCCCAGCCCAGG - Intergenic
904367576 1:30024557-30024579 CAGTCTTCACACCCCAACCATGG - Intergenic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904613243 1:31736561-31736583 GGCCCTGCTCACCCCAGCCCAGG + Exonic
905022823 1:34829530-34829552 CATCCTGGTCATCCCAGCCGAGG + Intronic
905205640 1:36341421-36341443 GAGCCTGCTCACCCCACTCCAGG - Exonic
905404140 1:37721887-37721909 CAGCCTGCCCAGCTCAGCCAGGG - Intronic
905642052 1:39596782-39596804 AAGCCTGCGCCCCCTAGCCATGG + Intergenic
905775123 1:40663458-40663480 CAGCCTGCTCCCCCCTCCCCAGG + Intronic
906705022 1:47888427-47888449 CAGGCTGTTCACCCCATACAAGG + Intronic
907429684 1:54405060-54405082 CAGCTAGCTCACCCCAAACAGGG + Intronic
908752224 1:67435340-67435362 CAGCCCGCGCACTCCAGCCTGGG - Intergenic
910092755 1:83484633-83484655 ACGCCTGCTCACCACAGGCAAGG + Intergenic
912459270 1:109820211-109820233 CAGCTTGGTGTCCCCAGCCAAGG + Intergenic
912509681 1:110180432-110180454 CAGCCAGCTCAGCTCAACCATGG - Intronic
912626867 1:111212696-111212718 AAGCTTTCACACCCCAGCCAGGG - Intronic
912649506 1:111425334-111425356 CAGCCTGCTCCACCCTCCCAGGG + Intronic
912947804 1:114099104-114099126 CAGCCTGCTCATCTCAGTCATGG - Exonic
913325114 1:117621341-117621363 CTTCCTGTTCACCCCAACCAGGG + Intronic
913711434 1:121487891-121487913 CAGCCTGCACATCTCACCCATGG + Intergenic
914385498 1:147165838-147165860 GAGCCTCCTCACTCCAGCCTGGG - Intronic
915111960 1:153569530-153569552 CAGTCTGCACCCCCCAGCAAAGG - Intergenic
915487239 1:156230180-156230202 CAGCCTGATCCTCACAGCCAAGG + Intronic
916085548 1:161266471-161266493 CAGCCTGTTCCCCCCAGCATGGG - Intronic
917643631 1:177008160-177008182 CTGCCTGCTCACCCAAGGAAGGG + Intronic
918045045 1:180936386-180936408 CAGCCTGAGCAGTCCAGCCAGGG - Exonic
919428289 1:197461333-197461355 CGGCCTGTCCTCCCCAGCCATGG - Intronic
919729016 1:200901149-200901171 CAGCCGGCTCACCTCGGCCCAGG - Exonic
919781573 1:201224686-201224708 CAGCCAGGTCACCTCAGGCATGG - Exonic
920051379 1:203166923-203166945 CAGCCTGCTAAACCCACCCCAGG - Exonic
920369452 1:205468932-205468954 GAGCATGCTCACCTCAGACAAGG + Intergenic
923495501 1:234521017-234521039 CAGCCAGCCCACCCTTGCCAGGG - Intergenic
1063158116 10:3398303-3398325 CAGCCTGCTCACCTGCACCATGG - Intergenic
1063449494 10:6142049-6142071 CAGCCTCCTGACTCCAGCCCAGG + Intergenic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1065160422 10:22914372-22914394 CACCTTGCTCACTCCAGCCTGGG + Intergenic
1065170936 10:23028099-23028121 CAGCCAGTGCACCCCAGCCTGGG + Intronic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1069446761 10:68479773-68479795 CAGCCTGGGCACTCCAGCCTGGG + Exonic
1069861738 10:71475820-71475842 CAGGCTTCTGACCCCAGGCATGG - Intronic
1069899132 10:71696929-71696951 CCTCCTCCCCACCCCAGCCAGGG + Intronic
1070543448 10:77434165-77434187 CAGCCTGCTGACCACTGGCAAGG + Intronic
1070785562 10:79160316-79160338 CAGTGTCCCCACCCCAGCCATGG - Intronic
1071298578 10:84240225-84240247 CAGCCTGCTGTTCCCAGCCTGGG - Intronic
1071315573 10:84392750-84392772 CAGCCTGCACACCCCAAAAAAGG - Intronic
1071346182 10:84696262-84696284 GACCCTGCTGACACCAGCCACGG + Intergenic
1071475643 10:86023062-86023084 CAGCCTCCAAACCCCAGCCCAGG + Intronic
1072211227 10:93248807-93248829 CCGCCTGCTCAGCCCATGCATGG - Intergenic
1072305486 10:94102702-94102724 CATCCTCCACACCCCAGCCCTGG + Intronic
1072337881 10:94415703-94415725 CAGCCTGGGCACTCCAGCCTGGG + Intronic
1072593883 10:96853603-96853625 CAGCCAAATCACCCCAGACATGG - Intronic
1072913986 10:99526181-99526203 CTGGCTTCTCACACCAGCCAAGG - Intergenic
1074424073 10:113335761-113335783 CACCCTGGTCTCCCCAGCCAAGG - Intergenic
1076054456 10:127360320-127360342 CATTGTGCTCACCCCAGCCGGGG - Intronic
1076300418 10:129421501-129421523 CAGCCTGCCCCCTCCAGCCATGG + Intergenic
1076634790 10:131875247-131875269 CTGCCCGCCCTCCCCAGCCAGGG + Intergenic
1076721267 10:132394427-132394449 TGGCCTTTTCACCCCAGCCAGGG + Intergenic
1076770708 10:132662677-132662699 CAGCATCCTCACCTCGGCCAAGG - Intronic
1076869532 10:133186537-133186559 GAGACTTCACACCCCAGCCAGGG + Exonic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1077799965 11:5527555-5527577 CACACTGCTCTCCCCAGCCCTGG - Intronic
1078339878 11:10491110-10491132 CCGCCTCCTCACCCCAGCCCGGG + Intronic
1078382321 11:10855339-10855361 AAGCCTGCCAACCCCTGCCATGG - Intronic
1079689383 11:23403483-23403505 CCGCCTGGCCACCCCAGCCCAGG + Intergenic
1079709701 11:23666231-23666253 CAAGCTGCACACCACAGCCAAGG + Intergenic
1080628987 11:34055190-34055212 CAGCCTGGGCACTCCAGCCTGGG - Intronic
1081573099 11:44303549-44303571 CACCCTACACACCCCAGCCTTGG + Intronic
1081785212 11:45741762-45741784 CAGCCAAGTCATCCCAGCCAAGG + Intergenic
1081833821 11:46137039-46137061 CAGCCTGCTCGCCCCAGCCTCGG + Intergenic
1081869572 11:46377191-46377213 CACCCTGCTCACCCACGCCCCGG + Exonic
1083652378 11:64210988-64211010 CAGCCTCCCCACCTCACCCATGG - Intronic
1083684907 11:64370173-64370195 CAGCCTCGGCACCCCAGCCTGGG + Intronic
1083714308 11:64567085-64567107 CAGGCTGCTCTCCCCAGAGAAGG + Intronic
1083880676 11:65546815-65546837 CAGCCTGGCTACCGCAGCCAGGG - Exonic
1084400326 11:68939536-68939558 GAGCCCTCTCACCGCAGCCATGG - Exonic
1085301696 11:75462587-75462609 CAGCCTCCTCACCAAAGCCCTGG + Intronic
1085455222 11:76661650-76661672 CAGCCTGATCACCCCATGCCTGG + Intronic
1085463056 11:76706801-76706823 CGTCCTCCACACCCCAGCCATGG - Intergenic
1085942623 11:81222914-81222936 CAGCCCCCACCCCCCAGCCAAGG - Intergenic
1088469278 11:110176485-110176507 CCTCCTGCTCCCCCCAGCCACGG + Intronic
1089570776 11:119407670-119407692 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
1089596654 11:119584995-119585017 CAGCCACCAGACCCCAGCCAGGG - Intergenic
1089751908 11:120657691-120657713 CCCTCTGCTCACCCCTGCCATGG - Intronic
1089812683 11:121144541-121144563 CAGCTTGCTCACTGCAGCAACGG - Intronic
1090050033 11:123369841-123369863 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1090229604 11:125092138-125092160 CAGCCTGTTCACCACAGGCCTGG + Intergenic
1090652419 11:128819256-128819278 CACCCTCCTCACCCCACCCCAGG + Intergenic
1091638101 12:2213431-2213453 CCTCCTCCTCACCCCAGCCCTGG - Intronic
1092880283 12:12882615-12882637 CAGTCTGCTCTCCCAGGCCATGG - Intergenic
1093171085 12:15861557-15861579 CAGACTACACAACCCAGCCAAGG - Intronic
1093383449 12:18521974-18521996 CAGCCCCCACCCCCCAGCCAAGG - Intronic
1093960261 12:25264898-25264920 CTCCTTGGTCACCCCAGCCATGG - Intergenic
1096814964 12:54196108-54196130 CACCCTCCTCCCCCCAGCAAAGG - Intergenic
1096916769 12:55041389-55041411 CAGCCTTCACACCCCAATCAAGG - Intergenic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1098756515 12:74370478-74370500 CAGTCTGATCACCCCAGCTTGGG + Intergenic
1099243270 12:80163683-80163705 AAGCCAAATCACCCCAGCCAAGG - Intergenic
1099397369 12:82157609-82157631 CAGGCGGATCACCCGAGCCAGGG + Intergenic
1101990086 12:109477316-109477338 CACCCAGCTCACGCCAGCCGGGG + Exonic
1102483347 12:113239260-113239282 AATCCTGCTCCCCCCAGCTAGGG + Intronic
1103908181 12:124337999-124338021 AACCCTGCTCCCCACAGCCAGGG + Intronic
1104483629 12:129130298-129130320 CAGCCTCCTCATCCCAGCTCAGG + Intronic
1104747576 12:131219797-131219819 CAGCCTGCTGGACACAGCCAGGG + Intergenic
1104792591 12:131493295-131493317 CAGCCTCCTCACACCTGCCCGGG - Intergenic
1104860308 12:131919970-131919992 CAGCCTGCGCACCACTGCAAAGG - Exonic
1105625231 13:22106330-22106352 CACCCTGCTCTCCCCTACCAGGG - Intergenic
1106132499 13:26951870-26951892 CAGCCTGCTAATTCCAACCAAGG + Intergenic
1106235545 13:27857506-27857528 CAGGCTGCTCAGCCAAGCCTGGG - Intergenic
1106614158 13:31310875-31310897 CAGCATGCCCAGCCCAGCTATGG + Intronic
1106810004 13:33350153-33350175 CAGCCCGCTCGCCCCGGCCTTGG + Intronic
1106840657 13:33682322-33682344 CAGCCGCCTCCCCCCAGGCAGGG + Intergenic
1107787547 13:43970744-43970766 CACCCTGCTCACCCACGCCCCGG + Intergenic
1109504773 13:63286201-63286223 CAACCTTCTGAGCCCAGCCATGG + Intergenic
1110567236 13:76968508-76968530 GAGCCCCCACACCCCAGCCAAGG - Intergenic
1111327791 13:86722003-86722025 TAGCTGGCTCACACCAGCCATGG + Intergenic
1111338142 13:86848078-86848100 CAGTCTGCCCACCACAGCCCTGG - Intergenic
1112494352 13:99893725-99893747 GAGCCTCCTGTCCCCAGCCAAGG + Exonic
1112997809 13:105595976-105595998 CAGCCTGCTCAGCCCAACTGTGG + Intergenic
1113200911 13:107867055-107867077 CAGCCCGCTCTCCCCTGCCAGGG + Intergenic
1113485792 13:110651548-110651570 CCTCCAGCTCAGCCCAGCCAAGG + Intronic
1113574589 13:111385686-111385708 CATCCTGCAAACCCCAGCCAGGG + Intergenic
1113707318 13:112443289-112443311 CTGCCTGCTCCACCCAGCCCCGG - Intergenic
1113966754 13:114157041-114157063 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
1119779050 14:77266136-77266158 CAGCCATCTCACCCCCGCCTTGG + Exonic
1121008208 14:90503852-90503874 CTGCCTGCTCACCTCCCCCAAGG - Intergenic
1121101757 14:91254275-91254297 CAGCCTGTCCAGCCCAGCCTGGG + Intergenic
1121580219 14:95024527-95024549 CAGCCACCTCTCCCCAGCAATGG + Intergenic
1121642365 14:95494349-95494371 CATCCTTCACATCCCAGCCAGGG - Intergenic
1121733475 14:96202415-96202437 CCCCCTGCAGACCCCAGCCAAGG + Intergenic
1121813874 14:96914327-96914349 CTCCTGGCTCACCCCAGCCATGG - Intronic
1122122022 14:99559846-99559868 CAGCCAGCACACCCCTGCCCGGG + Intronic
1122128583 14:99592430-99592452 GAGACTGCTCAGCCCAGCCCAGG + Intronic
1122297513 14:100713714-100713736 GAGCCTGCTGACCCCTCCCAGGG + Intergenic
1122355599 14:101121254-101121276 CAGGCTTCTGTCCCCAGCCAGGG - Intergenic
1122596391 14:102895908-102895930 CAGCCTGCTCACCCTCAACACGG - Intronic
1122823016 14:104356482-104356504 CAGCCAGCCCAGCCCAGCCCAGG - Intergenic
1122906570 14:104804313-104804335 CAGGCTGCCCACCCCAGCAAAGG - Exonic
1123538324 15:21261583-21261605 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1123695359 15:22875174-22875196 GAGCCTGCTGACCCCCACCAGGG - Intronic
1124159012 15:27252506-27252528 CATCCGCCCCACCCCAGCCAGGG + Intronic
1125761286 15:42097269-42097291 CATGCTGCTCACCCAGGCCACGG + Intergenic
1125832950 15:42729236-42729258 CAGCCTTCCCAGACCAGCCAGGG - Exonic
1126627316 15:50697330-50697352 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1126695326 15:51321089-51321111 CAGCCTGCTTACTTCATCCAGGG + Intronic
1127390873 15:58504141-58504163 GAGCTTGTTCACTCCAGCCAGGG - Intronic
1127464981 15:59235030-59235052 AAGCCTGCTCCCCAGAGCCATGG - Intronic
1127640937 15:60915200-60915222 TAGCCTGCTCTCCCCAGCATGGG + Intronic
1128709088 15:69858454-69858476 GGGGCTGCTCACCCCAGCTAGGG - Intergenic
1130367272 15:83251920-83251942 CAGCCTGCTGAGGCCAGGCATGG + Intergenic
1130573925 15:85073879-85073901 CTGCCTGCTCTCCCCAGTCAGGG + Intronic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1132552679 16:559936-559958 CCGCCGGCCCACCCGAGCCAGGG - Intergenic
1132620914 16:867921-867943 CTGCCTGGAGACCCCAGCCAAGG - Intronic
1132657264 16:1046569-1046591 CAGGCTGCAGCCCCCAGCCACGG + Intergenic
1132679538 16:1134121-1134143 GAGCCGACTCACCCCAGCCCTGG + Intergenic
1132937364 16:2487959-2487981 CAAGCAGCTCACCCCAGCCTCGG - Intronic
1133017997 16:2953787-2953809 CAGGCTGCTAGCACCAGCCACGG + Intergenic
1133031505 16:3013397-3013419 CAGCCAGCCCAGCACAGCCAGGG - Exonic
1134244912 16:12532813-12532835 CAGCCTGGTCAGCCTAGCGAGGG + Intronic
1135236482 16:20761135-20761157 CAGCCTGGGCACTCCAGCCTGGG - Intronic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137528699 16:49262331-49262353 CAGCCAGCTCATCTCTGCCAAGG + Intergenic
1137601212 16:49757656-49757678 CGGGCTCCTCACCCCACCCAAGG - Intronic
1137768152 16:50993649-50993671 CAGACTGCTAACCACAGCTATGG - Intergenic
1137800702 16:51259671-51259693 CAGCCTTCTCTAACCAGCCAAGG - Intergenic
1138187086 16:54985084-54985106 CAGCCTGCCAGCCCCAGGCAGGG - Intergenic
1139253840 16:65521914-65521936 CACCCTGCCAACCACAGCCAAGG + Intergenic
1139513881 16:67442225-67442247 CAGCCAGCTCGCTCCAACCAGGG + Intronic
1139949982 16:70663985-70664007 CAGCCTGCCCAACACAGCCTGGG - Exonic
1140055947 16:71525907-71525929 CTGCCTGCTCACTCCACCCTGGG - Intronic
1141384216 16:83604307-83604329 CAGACTGCTCACTCTTGCCATGG + Intronic
1141512940 16:84524449-84524471 AAGCCTGCTCACCAGGGCCATGG - Intronic
1141553428 16:84821169-84821191 GAGCCTGCTTTCCCCATCCAGGG + Intronic
1141604946 16:85147328-85147350 CAGCCTGCTCACCTGCCCCATGG + Intergenic
1141646278 16:85369749-85369771 CAGCCAGCTCAGCCCAGCCAGGG - Intergenic
1141993982 16:87625528-87625550 CAGCATGCACACTGCAGCCAAGG + Intronic
1142242576 16:88954327-88954349 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242715 16:88954802-88954824 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242755 16:88954935-88954957 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242761 16:88954954-88954976 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242817 16:88955144-88955166 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242857 16:88955277-88955299 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242863 16:88955296-88955318 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242920 16:88955486-88955508 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242940 16:88955543-88955565 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243057 16:88955904-88955926 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243070 16:88955942-88955964 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243083 16:88955980-88956002 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142876474 17:2854264-2854286 CAGGCTCCTCGCACCAGCCAGGG - Intronic
1142896124 17:2980319-2980341 AAGCTTGCTCAGTCCAGCCAAGG - Exonic
1142961008 17:3552640-3552662 AAGCCTCCTCCGCCCAGCCAAGG - Intronic
1143361619 17:6375775-6375797 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1143508217 17:7381140-7381162 CCGCCGGCTCTCCCCAGCCCGGG - Intronic
1143530316 17:7499170-7499192 CAGCCTGCTTCCCTCAGCCAGGG - Intronic
1143682177 17:8484343-8484365 CAGCCTGGGCAACACAGCCAGGG - Intronic
1143904161 17:10196651-10196673 CAGCTGGCTCAGTCCAGCCAGGG + Intronic
1144268465 17:13594320-13594342 CAGCCTGCTCTCCCAGGCCCTGG + Intronic
1144621865 17:16823177-16823199 CAGGCAGCTCTCCCCAGCCCTGG + Intergenic
1144702824 17:17349932-17349954 CAGCAAGCTCCCCCCAGCCCTGG - Intergenic
1144884559 17:18449537-18449559 CAGGCAGCTCTCCCCAGCCCCGG - Intergenic
1145193358 17:20866995-20867017 CAGCCAGCGCTCCCCACCCAAGG + Intronic
1145203769 17:20969536-20969558 CAGCTTGCCCACTCCAGCCCAGG - Intergenic
1145298663 17:21614086-21614108 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1145723151 17:27090822-27090844 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1146163269 17:30571125-30571147 CAGCCTGCTGCCCCCAGAAAAGG + Intergenic
1146654879 17:34629194-34629216 CTGCCTGCTCACCATGGCCAGGG - Exonic
1146719655 17:35114972-35114994 CAGACTGATCTCCACAGCCAAGG - Intronic
1147141843 17:38464769-38464791 CTGCCAGCCCACCCCAGCCTGGG - Intronic
1147190520 17:38735537-38735559 CAAGCGGCTCACCCTAGCCACGG - Exonic
1147998860 17:44376043-44376065 GGACCCGCTCACCCCAGCCAGGG + Intronic
1148079470 17:44959876-44959898 CTGCCAGCCCACCCCAGCCTGGG - Exonic
1151534440 17:74730686-74730708 CAGTCTGCTCTCAGCAGCCAGGG + Intronic
1151725597 17:75882005-75882027 CAGCCTGGGCACCAAAGCCACGG - Intronic
1151896062 17:76981735-76981757 CAGCCTGCCCACCCCTGCCATGG + Intergenic
1152094339 17:78264256-78264278 CACCCTGGGCACCCCAGGCATGG + Intergenic
1152335637 17:79699062-79699084 CACCCTGCTGACCACACCCACGG + Intergenic
1152743636 17:82029454-82029476 CATCCAGCCAACCCCAGCCAGGG - Intronic
1153342959 18:3994170-3994192 CACCCTCGGCACCCCAGCCAGGG - Intronic
1153522983 18:5969349-5969371 CAGCAGGCACACCCCAGCCCTGG + Intronic
1153739836 18:8112389-8112411 CTGCCTGCTATCCCCACCCATGG - Intronic
1153958040 18:10114980-10115002 CAGACTGCTCTGGCCAGCCAGGG + Intergenic
1155555630 18:27016052-27016074 GACCCTGCTCATCCCAGCCATGG + Intronic
1156451082 18:37266814-37266836 CAGCTTGCATCCCCCAGCCAGGG - Intronic
1157288881 18:46395982-46396004 CTGCCTGGTCATTCCAGCCAAGG - Intronic
1157491675 18:48127942-48127964 GAGGCTGCCCAGCCCAGCCAAGG + Intronic
1157644940 18:49258669-49258691 CTGCCTACTCTCCACAGCCATGG - Intronic
1157751158 18:50179689-50179711 CAGCCTGCTCTCTAAAGCCATGG + Intronic
1160019989 18:75172920-75172942 CAGCCTTCTCACCCAGGTCAAGG + Intergenic
1160293511 18:77617011-77617033 CCTCCTGCACACCCCAGGCAGGG - Intergenic
1160803150 19:979768-979790 CCCCCAGCTCTCCCCAGCCAGGG + Intergenic
1160846683 19:1169139-1169161 CGATCTGCTGACCCCAGCCAGGG + Intronic
1161351215 19:3792991-3793013 TAGCTTCCTCCCCCCAGCCAGGG + Intronic
1161664701 19:5568179-5568201 CAGCGAGGTCATCCCAGCCAAGG + Intergenic
1161810026 19:6466272-6466294 GAGCCTTCGCACCCCAGACAAGG + Intronic
1162674776 19:12290757-12290779 CAGCCTAATCACTCCAGCAATGG - Intronic
1162704826 19:12547650-12547672 CAGCCTTATCACTCCAACCAGGG - Intronic
1163879198 19:19902617-19902639 CAGCCTATTCACCGGAGCCATGG + Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163939847 19:20481490-20481512 CAGCCTGCGCATCCTAGCAATGG + Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164005585 19:21145546-21145568 CAGTCTGCTCAACCCAGCCATGG + Intronic
1164027175 19:21363409-21363431 TAGCCTGCTCACTCCAGTCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164053270 19:21600995-21601017 TAGCCTGCTCACAATAGCCATGG - Intergenic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164241302 19:23391758-23391780 CAGCTTGCTCACCTCAGCTATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1165200795 19:34142784-34142806 CAACCTGCTCAACCCCACCATGG + Intergenic
1165739828 19:38198501-38198523 CAGCCTGGTGAACGCAGCCAAGG + Exonic
1166218436 19:41351402-41351424 CGCCCTCCTCACCCCAGCTACGG - Intronic
1167142418 19:47661258-47661280 CATCTTCGTCACCCCAGCCAAGG - Intronic
1167722840 19:51190662-51190684 AAGCATCCTCCCCCCAGCCATGG + Intergenic
1168403204 19:56097982-56098004 CGGCCTGCTAAGCCCAGCAAGGG + Intronic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
926123003 2:10254986-10255008 CAGCCGGCGCATCCCGGCCAGGG - Intergenic
926629193 2:15121361-15121383 CAACCTGCTCAGACAAGCCATGG + Intergenic
926745622 2:16154658-16154680 CTCCCTGCACACCCAAGCCAAGG + Intergenic
927146864 2:20171916-20171938 AAGCCTGCTGAGCCCAGCCTGGG + Intergenic
927808850 2:26171002-26171024 CAGCCCGCTCACCCTGGCCAGGG - Intergenic
930362812 2:50403060-50403082 CAGGCTGGGCACCCCAGGCATGG + Intronic
930636552 2:53812197-53812219 GAGCCTCCGCGCCCCAGCCAGGG + Intronic
932100964 2:68898601-68898623 CTGCTTGCCCACCCTAGCCATGG - Intergenic
932414915 2:71567846-71567868 CAGCCTGCTCTACCCAGGCTTGG + Intronic
932707492 2:74038009-74038031 CACCCTGCTCTCCCCACCCAGGG - Intronic
933247045 2:79987160-79987182 CTGGCCCCTCACCCCAGCCAGGG + Intronic
934114090 2:88766671-88766693 CTGGGTGCTCACCCCCGCCAAGG - Intergenic
934647175 2:96065737-96065759 GAGCCTGCTCATCCCACCCTGGG - Intergenic
934925921 2:98381724-98381746 CAGCCTCCTTCCCCCAGCCCAGG - Intronic
935555885 2:104508953-104508975 TAGGCTGCTCTCTCCAGCCAGGG + Intergenic
936044613 2:109176990-109177012 AAGCCTGCTCACCCCAGTGCAGG - Intronic
936849169 2:116874430-116874452 GAGTCTTCTCACCCCAGCTAGGG - Intergenic
937280217 2:120712590-120712612 GATCCTGCCCACCCCAGTCATGG - Intergenic
937308267 2:120885439-120885461 GAGCCTGGCCACCCCAGCCTCGG + Intronic
937594126 2:123652357-123652379 CAGCCTGCTGAGCCTAGCCAGGG - Intergenic
937908017 2:127061811-127061833 CAGGCTGCCCACCCCAACCCTGG + Intronic
937913962 2:127089917-127089939 CCCCCTGCTCCCCCCACCCAGGG + Intronic
938296230 2:130181398-130181420 CAGCCGGCTCTGCCCAGGCAGGG - Intronic
939884361 2:147665213-147665235 CACCCTGGTCAACCTAGCCAAGG - Intergenic
940743828 2:157544503-157544525 CAGCTTGATCATTCCAGCCACGG + Exonic
943351865 2:186805864-186805886 CTGCCTGCAGTCCCCAGCCAGGG + Intergenic
944494346 2:200291210-200291232 CAGCCTGCTCAGTTCAGCCCAGG - Intergenic
946173138 2:217907149-217907171 CAGCCTTCTCACACCTGCCCAGG + Intronic
946396847 2:219447694-219447716 CAGCCTCCTCCCCCCAGCCCTGG - Intronic
947812106 2:233011077-233011099 CAGCCCTCTCACCCCAACAACGG - Intronic
948934960 2:241157869-241157891 CCGCCTGCTCAGCCCAGCCTTGG + Intronic
949012716 2:241690489-241690511 CAGCCTGCTGACCTCAGCCCTGG + Intergenic
1168956959 20:1841156-1841178 CATCCTGCTCCCCCGACCCAAGG + Intergenic
1168964465 20:1890960-1890982 CTGCCTGCTGACGCCAGCCCAGG + Intergenic
1168976442 20:1969632-1969654 CAGCCCCCTCACTCCCGCCAAGG + Intergenic
1169933014 20:10854021-10854043 CAGCCTGGGCTCCCCATCCAGGG - Intergenic
1169980521 20:11379442-11379464 GAACCTCCTCCCCCCAGCCAAGG + Intergenic
1171561916 20:26134489-26134511 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1172181895 20:33008573-33008595 CAGCCTACTTGCCCAAGCCATGG - Exonic
1172528249 20:35614016-35614038 CAGGCTGCACACCTGAGCCATGG - Intergenic
1172896650 20:38304837-38304859 CAGACCACTCACCCCAGCCCAGG + Intronic
1172972595 20:38884209-38884231 CAGCCTGCTCAGCCACGCCAGGG - Intronic
1174035002 20:47663420-47663442 CAGCCTGTCCACCCCTGCCCTGG + Intronic
1174386046 20:50189295-50189317 CAGCCCACTGACCCCAGCCCTGG - Intergenic
1175389301 20:58616184-58616206 CAGCAGGGTCACCACAGCCATGG + Intergenic
1175484204 20:59333411-59333433 GAGCCAAGTCACCCCAGCCAGGG - Intergenic
1175796422 20:61774088-61774110 GTGCCTCCACACCCCAGCCAAGG + Intronic
1175968243 20:62670665-62670687 CAGCCTGCTGCTCCCAGCTAAGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178166707 21:29986000-29986022 CAGCATGCCCACTCCAGCCATGG + Intergenic
1178919781 21:36731157-36731179 TAGCACGCCCACCCCAGCCACGG + Intronic
1179397305 21:41053020-41053042 CAGCGTCCTCGCCCCATCCAGGG - Intergenic
1179470278 21:41605665-41605687 CAGCCTGCTCTGCTCACCCACGG - Intergenic
1179519175 21:41931198-41931220 GAGCCTGCTCACAGCAGCCGTGG + Intronic
1179648546 21:42791554-42791576 CTGCCTGCTCTCCCTAGCCCTGG + Intergenic
1179660132 21:42869003-42869025 TAGCCTGTTCCCCCCCGCCAGGG - Intronic
1180825627 22:18858945-18858967 CAGGCTGCTCACCCCAGGCCTGG - Intronic
1181187106 22:21115602-21115624 CAGGCTGCTAACCCCAGGCCTGG + Intergenic
1181212095 22:21294891-21294913 CAGGCTGCTAACCCCAGGCCTGG - Intergenic
1181347493 22:22230525-22230547 CAGGCTGCTGCCCCCAGTCATGG + Intergenic
1181397401 22:22631995-22632017 CAGGCTGCTAACCCCAGGCCTGG + Intergenic
1181417647 22:22771960-22771982 CATCCTGCCCACCACAGGCAGGG - Intronic
1181423698 22:22819251-22819273 CATCCTGCACACCACAGGCAGGG - Intronic
1181500152 22:23311370-23311392 CAGGCTGCTAACCCCAGGCCTGG + Intronic
1181580988 22:23827922-23827944 CAGCCTCCTTTCCCCAGGCAGGG - Intronic
1181652006 22:24264067-24264089 CAGGCTGCTAACCCCAGGCCTGG - Intergenic
1181705372 22:24646676-24646698 CAGGCTGCTAACCCCAGGCCTGG + Intergenic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1183442042 22:37828714-37828736 CAGCCACTTCACCCCAGCCCGGG - Intergenic
1183593292 22:38794098-38794120 CAGCCAGCGAACCCCCGCCAGGG + Exonic
1183935296 22:41258426-41258448 GTGCCTGCCCACCACAGCCAGGG - Intronic
1184091473 22:42295152-42295174 AAGCCTCCTAACCCCAGCCTGGG + Intronic
1184399522 22:44265780-44265802 CAGCTTGCACACCCCAGCGATGG + Intronic
1184737806 22:46409482-46409504 CAGCCCCAGCACCCCAGCCACGG - Intronic
1184755083 22:46511342-46511364 CTGGCTGCTCACCACAGCCCAGG + Intronic
1184926279 22:47642057-47642079 AAGCCTGCTCGCTCTAGCCAAGG + Intergenic
1185128832 22:49026004-49026026 CACCCAGCTGACCCCATCCAGGG - Intergenic
1185244090 22:49764006-49764028 CAGCCTGGGCACCCCACCCAAGG + Intergenic
1185322970 22:50210346-50210368 CAGCCCGCACCCCCCAGCCCTGG - Intronic
1203214860 22_KI270731v1_random:541-563 CAGGCTGCTCACCCCAGGCCTGG + Intergenic
1203275776 22_KI270734v1_random:84851-84873 CAGGCTGCTAACCCCAGGCCTGG - Intergenic
949497373 3:4645301-4645323 CAGACTTCTCACCGCAGCCTAGG - Intronic
949863618 3:8528930-8528952 CATCCTACTAACCCAAGCCAAGG + Intronic
950035133 3:9879791-9879813 CATCCTGCTCTTCCTAGCCAAGG + Intronic
950070045 3:10144537-10144559 CAGCCTCCACACTCCAGCCCAGG - Intronic
950193148 3:10992045-10992067 GAGCCTGGTCACCCCAGGCCAGG + Intergenic
950349087 3:12329026-12329048 CAGCTGGCTCATCCCAGCCCAGG + Intronic
950473156 3:13198941-13198963 CAGCCTCCCAAGCCCAGCCATGG - Intergenic
950565563 3:13767841-13767863 CAGCCTCCTGACCCCTGCCTGGG + Intergenic
950716118 3:14848835-14848857 CTGACTTCTCACACCAGCCAGGG - Intronic
950888611 3:16382913-16382935 GAGCCAGGTCACCTCAGCCATGG + Intronic
952965928 3:38621265-38621287 CAATCTCCTCACCCCAGCCCTGG + Intronic
953213547 3:40897378-40897400 CTGCTTTCACACCCCAGCCAGGG - Intergenic
953702939 3:45210709-45210731 CAGCCTGCACCTCCCAGCAAGGG + Intergenic
955436042 3:58899709-58899731 CAGTCCCCCCACCCCAGCCAAGG - Intronic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
961371334 3:126433758-126433780 CAGGCAGCTCAGCCCAGCCTGGG - Intronic
961727496 3:128942361-128942383 CAGGCAGCTCGCCCCAGCCCTGG + Intronic
961772476 3:129260164-129260186 CACCCTGCGCACCTGAGCCATGG - Intronic
961812310 3:129528955-129528977 CATCCTGCTCAACCTAGCCGTGG + Exonic
961822562 3:129582597-129582619 AGGCCTTATCACCCCAGCCAAGG + Intronic
962355040 3:134686430-134686452 CAGCCTGCTGACCCTAGCCCAGG - Intronic
963403084 3:144826450-144826472 AAACCTGGCCACCCCAGCCATGG - Intergenic
963679410 3:148355003-148355025 CAGCCTGGGCAACTCAGCCAAGG + Intergenic
964627901 3:158776731-158776753 CAGGCCGCTCTCCCCAGCCCTGG - Intronic
964630272 3:158802305-158802327 CGGCCGGCTCACCAAAGCCAAGG - Exonic
964763939 3:160160214-160160236 CAGCCTACTGACCCCAGCACAGG + Intergenic
965728771 3:171747323-171747345 CAGTGTGCTCAGCACAGCCAAGG - Intronic
965812034 3:172601154-172601176 CAGCCTGTTGTCCCAAGCCAAGG - Intergenic
967183091 3:186923332-186923354 CAGCCTGCAGACCTCAGCTAAGG - Intergenic
968117561 3:196101222-196101244 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
968280449 3:197472962-197472984 CACCATGCTCAGCCCATCCAGGG + Intergenic
969834875 4:9832389-9832411 CAGCCTCCTGACCCAAGCCTGGG - Intronic
970721522 4:18995029-18995051 CTGCCTGGCCACCCCAGCCATGG + Intergenic
971775340 4:30956183-30956205 CAGCCTGGGCACTCCAGCCTGGG + Intronic
971914632 4:32851708-32851730 CAACCTACTGACACCAGCCAGGG - Intergenic
974723726 4:65773561-65773583 CAGCATTCTCACCACAGCAATGG + Intergenic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
977133582 4:93272712-93272734 CAGTCTTCTCACTCCTGCCATGG - Intronic
978761592 4:112359495-112359517 CAGCCAGCCCAACCCAGGCATGG + Intronic
981078858 4:140618317-140618339 CAGCATCCTCACCCCCACCAAGG - Intergenic
982262363 4:153505877-153505899 CAGCCTCCTCACCACACCCTGGG - Intronic
983819394 4:172173832-172173854 AAGCTTGATCACCCCAGCAATGG + Intronic
983943938 4:173565291-173565313 CAGCCACCTTCCCCCAGCCAGGG - Intergenic
984741038 4:183163287-183163309 CTGCCAGCTCACCCCTGCCCTGG + Intronic
984952300 4:185016788-185016810 CCGCCTACCCACCCCTGCCAAGG + Intergenic
985236888 4:187884987-187885009 CTGCCCACTCCCCCCAGCCATGG + Intergenic
985520541 5:372178-372200 CCGCCAGCCCACCCCAGCCCTGG - Intronic
985522127 5:379047-379069 CAGCCCCCTGCCCCCAGCCACGG + Intronic
985533473 5:447706-447728 CAGCCAGCTCGCCGCAGCCGTGG + Exonic
985781155 5:1872479-1872501 CACCCCGCTCACCACAGCCTGGG + Intergenic
986006407 5:3672414-3672436 CTCCCTGCACACTCCAGCCATGG - Intergenic
988891150 5:35618245-35618267 CCTACAGCTCACCCCAGCCAGGG + Intronic
991002500 5:61796448-61796470 CAGCTGACTCACCTCAGCCATGG + Intergenic
993634279 5:90325739-90325761 CGGGCTGCACACCACAGCCATGG + Intergenic
998217022 5:140245193-140245215 CAGCTGGCTCATCCCAGCCCAGG - Exonic
1002040203 5:176507913-176507935 CATGCTGCTCCCCCCAGCCCTGG + Exonic
1002322222 5:178382823-178382845 CAGCCTTCTGACTCCTGCCAAGG - Intronic
1002439813 5:179258458-179258480 AAGCCTGGCCACCCCAGCCTCGG + Intronic
1002874961 6:1202560-1202582 CTCCCTCCTCACCCCAGCCATGG + Intergenic
1003485981 6:6579984-6580006 CTGCCTGCTCTCCCCTGCCCTGG - Intergenic
1003874812 6:10426069-10426091 TAGCCTTCTCACCCGAGGCAAGG - Intergenic
1004718464 6:18242542-18242564 CATCCTGCTCACTCCTGCCCGGG + Intronic
1006046946 6:31306789-31306811 CAGCCTGCCTTCCACAGCCAAGG + Intronic
1006838651 6:37014502-37014524 CTGCCTGTGCAGCCCAGCCATGG - Intronic
1006915232 6:37589673-37589695 CAGTCTGATCACCCCAGCTAAGG + Intergenic
1007090913 6:39184434-39184456 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1007222932 6:40293402-40293424 CACCCTGCCCACCCCTCCCAAGG - Intergenic
1007759986 6:44127905-44127927 CCGCCGGCTCTCCCCAGCCCCGG + Intronic
1010283181 6:74043551-74043573 CAGCCTGCTCACCACAGCAGGGG + Intergenic
1010465995 6:76166934-76166956 CAGGCTGCACACCACAGCCTTGG - Intergenic
1010767600 6:79794066-79794088 CAGGCTGCTCTGTCCAGCCATGG - Intergenic
1010809971 6:80289967-80289989 CTGCCTGCTGGCCCCACCCAGGG + Intronic
1011616200 6:89200486-89200508 CAATCTGCCCACCTCAGCCATGG + Intronic
1012075029 6:94672550-94672572 CAGTCTCCTCCCACCAGCCATGG - Intergenic
1013358402 6:109368910-109368932 CAGCCTGCACACCCAAGACCAGG + Exonic
1014272484 6:119349627-119349649 CAGCGCGCTCAGCCCAGCCTAGG - Exonic
1014674707 6:124349284-124349306 CAGCCTGCTCCCCCCTACAAAGG + Intronic
1014755931 6:125301944-125301966 CGGCCTGCTCCGCCCAGCCGGGG - Exonic
1014884425 6:126762166-126762188 CAGCCTGCTTTCCTGAGCCACGG - Intergenic
1015136942 6:129882890-129882912 GAGCCCCCACACCCCAGCCAAGG - Intergenic
1016369921 6:143362781-143362803 CTGCCTGCTTACCCTACCCACGG + Intergenic
1016534298 6:145093201-145093223 CAGCAGGCTGTCCCCAGCCAAGG - Intergenic
1017187838 6:151620406-151620428 CAGCCTAGTGACCTCAGCCAGGG - Exonic
1017755627 6:157526785-157526807 CAGCCTTCTCAGCCGAGCCCTGG - Intronic
1018070929 6:160163800-160163822 CGTCCTGCTCAGACCAGCCAGGG - Intergenic
1019305478 7:332555-332577 CAGCCCGCCCACCCCTGCCCTGG - Intergenic
1019434456 7:1014970-1014992 CTGCCTGCTCCTCCCAGCCCTGG - Intronic
1019477326 7:1250143-1250165 CTGCCCCCTCACCCCTGCCACGG - Intergenic
1020156876 7:5733085-5733107 CAGCCTGCTCAACTCAGCTTTGG + Intronic
1022339747 7:29456838-29456860 CAGCGTGCCCTCCCCAGCCCAGG - Intronic
1023624082 7:42099029-42099051 CTGCCTGCTCCCCCGTGCCAAGG + Intronic
1023834794 7:44061825-44061847 GAGGGTGCTCACCCCAGACACGG - Intronic
1024033394 7:45484305-45484327 CTGCCTGCTCACCCCTGCAGAGG + Intergenic
1024099409 7:46015323-46015345 GAGCCCCCTCCCCCCAGCCAAGG + Intergenic
1024157938 7:46645416-46645438 CACCCTGCTCCTCCCAACCAGGG - Intergenic
1024255716 7:47538515-47538537 CAGACTGCTCCCCACATCCAAGG - Intronic
1024264117 7:47593671-47593693 CAGCTTGCTCTCCGGAGCCAAGG - Intergenic
1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG + Intergenic
1024783250 7:52876146-52876168 CAGCCTGTTCACTCCAGACAAGG - Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025275950 7:57581204-57581226 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025778833 7:64581584-64581606 CAGCTTGCTCACACCAGCCGTGG + Intergenic
1025788968 7:64669993-64670015 TCCCCTGCTCACCCCAGCCATGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1026289561 7:68994166-68994188 ATGCCGGCTCACCCCAGGCATGG + Intergenic
1026480217 7:70772207-70772229 CAGCCATCCCACCCCTGCCATGG + Intronic
1026480392 7:70773828-70773850 CAGCTTGCTCTCTCCAGCAATGG - Intronic
1027309615 7:76941129-76941151 ACGCCTGCTCACCACAGGCAAGG + Intergenic
1027856271 7:83515640-83515662 TAGACTGCTCACCTCAGCAATGG + Intronic
1028144057 7:87302437-87302459 CAGTCTTCTCATCTCAGCCAGGG - Intergenic
1028145716 7:87317990-87318012 CACCCTGCTCACCCCTGCCCAGG - Intergenic
1028609622 7:92695751-92695773 CAGCCTGCCTTCCCCACCCAGGG - Intronic
1029041372 7:97580011-97580033 GAGCCCCCACACCCCAGCCAAGG + Intergenic
1029321326 7:99763129-99763151 CAGCCTGCACAGCACACCCAGGG + Intronic
1029331530 7:99860371-99860393 CAGCCTGCCCAGCGCACCCAGGG - Intronic
1029421943 7:100476479-100476501 CTGGCTGCTCACCCCCACCATGG + Intronic
1029477437 7:100793298-100793320 CAGCCTGGGCACTCCAGCCTGGG + Intronic
1029609549 7:101619378-101619400 GAGCCTGCCCTCCCCAGCCCTGG + Intronic
1029735256 7:102462096-102462118 CAGCCTGCTCAGCCGACACACGG - Intronic
1029978015 7:104852342-104852364 CAGCCTGCTGCCCCCAGCAGTGG + Intronic
1030037072 7:105416986-105417008 CAGTTTGCTCACCCCATCCGAGG + Intergenic
1030267668 7:107636893-107636915 CAGCCAGTGCACCCCAGCCTGGG + Intergenic
1031973966 7:128082385-128082407 CAGCCTCCTCAGCCCACCCCAGG + Intronic
1032414434 7:131725488-131725510 CAGCCTCCTCCCCTGAGCCAGGG - Intergenic
1033035748 7:137874286-137874308 CAGCATGCTCAACCCTGCCCTGG - Intergenic
1033236777 7:139644388-139644410 CAGCCTGCACACTCAAGCCTGGG + Intronic
1033453460 7:141481885-141481907 CATCCTACTCACCCCTGCCCGGG - Intergenic
1033640989 7:143263326-143263348 CAGCCTACGGCCCCCAGCCAGGG - Intronic
1033879325 7:145862170-145862192 GAGCCTTCTCCCCCGAGCCAAGG + Intergenic
1035464468 7:159065440-159065462 CAGCCTCCACTCTCCAGCCACGG - Intronic
1035581929 8:745982-746004 CGGCCTGCTCAGGCCAGCCAAGG + Intergenic
1035678832 8:1472748-1472770 CATCCTTGTCACCCCAGCTAGGG - Intergenic
1038189958 8:25311253-25311275 CACCCTGCTCGGCCAAGCCATGG - Intronic
1038197021 8:25377862-25377884 CAGGAAGCTCACCCAAGCCATGG + Intronic
1038454116 8:27661067-27661089 GAGCCTGCTCACGCCAGGGAGGG + Intronic
1039293931 8:36128127-36128149 GAACCTCCTCCCCCCAGCCAAGG - Intergenic
1039822029 8:41142894-41142916 CACCCTGCTCACCCAGCCCACGG + Intergenic
1040288348 8:46111776-46111798 CAGCCTGCTCAGGACAGCCCTGG + Intergenic
1040301222 8:46188993-46189015 CAGCCTGCCCACAACAGCCCTGG - Intergenic
1040312353 8:46243305-46243327 CAGCCTGCCCAGCGCAGCCCTGG - Intergenic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1040587192 8:48755364-48755386 CCTGCTGCTCACCCCAGCCCCGG + Intergenic
1041450953 8:58006444-58006466 CAGCCTACTGAACCCTGCCATGG - Intronic
1041625094 8:60016191-60016213 TGACCTGCTCAACCCAGCCAGGG + Intergenic
1042798951 8:72696610-72696632 CAGGCTGCTCTCTCCATCCACGG - Intronic
1047174370 8:122526674-122526696 CCGCATGCACACCCCACCCATGG + Intergenic
1049200742 8:141339481-141339503 CACCCAGGCCACCCCAGCCAGGG - Intergenic
1049204606 8:141357929-141357951 CAGCCAGCACACCCCAGGCCTGG + Exonic
1049212985 8:141395320-141395342 CAGGCTGTTCCTCCCAGCCAAGG + Intronic
1051364588 9:16312473-16312495 CAGCCTGCTTGCCCCACCCTGGG + Intergenic
1051825502 9:21213813-21213835 CAGCCTGCTCTCCACAGACTTGG + Intronic
1052176729 9:25472102-25472124 CAGCCAGGTCCTCCCAGCCAGGG - Intergenic
1053283852 9:36838234-36838256 AAGCCTGGTCACCCAGGCCAGGG - Exonic
1056013537 9:82357619-82357641 CAGCCACCTCACTCCAGCCTGGG + Intergenic
1056412587 9:86345916-86345938 TAGCCAGTTCACTCCAGCCAGGG - Intronic
1056587441 9:87937935-87937957 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1056595130 9:88001867-88001889 CATCCCAGTCACCCCAGCCATGG + Intergenic
1056609435 9:88115007-88115029 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1056719697 9:89061058-89061080 CAGCATTCTCAGCCCAGGCATGG + Intronic
1056731207 9:89168005-89168027 CAGCTTGCGAACCACAGCCATGG + Intronic
1056931069 9:90877837-90877859 CAGGCTGCTCGGCCCATCCAGGG - Intronic
1057134395 9:92677013-92677035 CAGCCTGCTCCACCCAGAGAAGG - Intergenic
1058880975 9:109285767-109285789 CAGCCTGGACACCCCACCCGGGG + Intronic
1059923170 9:119180018-119180040 CAGCCTGGGCTCCCCAGCCAGGG - Intronic
1059988175 9:119839923-119839945 CAGCCTCCCCGCACCAGCCATGG - Intergenic
1060528632 9:124334647-124334669 CAGCCGGCTCTCCCTGGCCAGGG + Intronic
1060945270 9:127566757-127566779 CACCCTCCTCACCCCACCCAAGG - Intronic
1061249812 9:129420204-129420226 CATTCTGCTCCCCCCATCCAAGG - Intergenic
1061852075 9:133422269-133422291 CAGGCCGCCCACCCTAGCCACGG + Exonic
1062031883 9:134365521-134365543 CAGCCTGGTCCACACAGCCATGG - Intronic
1062290356 9:135791640-135791662 CATCCTGGTGAGCCCAGCCAGGG - Intronic
1062523849 9:136970448-136970470 CAGCCTGCTCACCTGAGGCTGGG + Intronic
1186384543 X:9095422-9095444 TAGCATGCTCAGCACAGCCAAGG + Intronic
1189074894 X:37905320-37905342 CCTACTGCTCACCACAGCCAAGG - Intronic
1189304387 X:39975625-39975647 CAGCCTGCTCTCAGCAGACAGGG - Intergenic
1189571791 X:42306382-42306404 AAGCCCCCTCCCCCCAGCCAAGG + Intergenic
1190214503 X:48470570-48470592 CCGCCTGCCCACCCCCGACAGGG + Intergenic
1190339619 X:49286333-49286355 CAGCGTGATCTCCTCAGCCAGGG - Exonic
1190481609 X:50882921-50882943 CAACCTCCTCACCACTGCCAGGG + Intergenic
1190592163 X:52014955-52014977 AAGCCTCCTGAACCCAGCCAAGG - Intergenic
1191255933 X:58279646-58279668 CAGCCCCCGCACCCCACCCAGGG - Intergenic
1191775294 X:64807509-64807531 GAGAGTCCTCACCCCAGCCAAGG + Intergenic
1191842767 X:65524867-65524889 CAGCCTTCACACCCCAACCCAGG + Intronic
1192522460 X:71814656-71814678 CCGCAGACTCACCCCAGCCATGG + Intergenic
1192756382 X:74050198-74050220 CAGGCTGCACACCACAGCCACGG - Intergenic
1194631976 X:96296329-96296351 CAGCCTGAACACACCAGCAAAGG - Intergenic
1195728311 X:107939748-107939770 CACCCAGCCCACCCCAGCAAGGG + Intergenic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1200002181 X:153067687-153067709 CAGCCTGCTCCAGCCTGCCAGGG - Intergenic
1200005552 X:153082338-153082360 CAGCCTGCTCCAGCCTGCCAGGG + Intergenic
1200403719 Y:2787019-2787041 CAGCCAGCTCACCGCAGCAACGG - Exonic
1200909417 Y:8517036-8517058 CTGCATGCTCATACCAGCCACGG - Intergenic