ID: 1163889745

View in Genome Browser
Species Human (GRCh38)
Location 19:20000246-20000268
Sequence CAGAGTTGTCTCTAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163889745_1163889751 30 Left 1163889745 19:20000246-20000268 CCCACCTCCTAGAGACAACTCTG 0: 1
1: 0
2: 2
3: 11
4: 176
Right 1163889751 19:20000299-20000321 GAGAGTAACATGCTCTTCCATGG 0: 1
1: 0
2: 0
3: 9
4: 132
1163889745_1163889749 -7 Left 1163889745 19:20000246-20000268 CCCACCTCCTAGAGACAACTCTG 0: 1
1: 0
2: 2
3: 11
4: 176
Right 1163889749 19:20000262-20000284 AACTCTGTATCCAGCTTCTTTGG 0: 1
1: 0
2: 0
3: 60
4: 1615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163889745 Original CRISPR CAGAGTTGTCTCTAGGAGGT GGG (reversed) Intronic
900319507 1:2075637-2075659 CAGAGGTGAGTCTGGGAGGTGGG - Intronic
901217511 1:7563012-7563034 GAGAGTCGTCTCTAGAATGTGGG - Intronic
902155801 1:14485338-14485360 CAGATATGTCTTTATGAGGTAGG + Intergenic
903256205 1:22102578-22102600 CAGAGTTGTCATTAGGATTTAGG + Intergenic
904031701 1:27537140-27537162 CAGGGTTCTCTCATGGAGGTGGG + Intronic
904501482 1:30915289-30915311 CTCAGCTGCCTCTAGGAGGTGGG + Intergenic
904627786 1:31816894-31816916 CACAGTTGTTTCCAGGAGTTGGG - Intergenic
904682039 1:32235867-32235889 CAGAGCAGTTTCTGGGAGGTAGG - Intergenic
907866871 1:58407140-58407162 CAAAGTCCTCTCTAGCAGGTAGG - Intronic
907965847 1:59328783-59328805 CAAAGTTGTGTCTCGGGGGTAGG + Intronic
908799980 1:67869888-67869910 CAGAGATGTCTTAAGGAGGTAGG + Intergenic
909174999 1:72346323-72346345 CAGAGTGGCCTCCAGGAGTTAGG + Intergenic
914939658 1:152011760-152011782 CAGAGCTTTCTCTAGTGGGTAGG - Intergenic
916015820 1:160749126-160749148 CAGACTTGCTTGTAGGAGGTAGG + Intronic
916291025 1:163166226-163166248 CAGAGCTGTCTTTAGGGGGTAGG + Intronic
916317777 1:163469587-163469609 CAGAGTTCTCTCAAAGAGGAAGG + Intergenic
917349569 1:174063022-174063044 CAGAGTTGTGGGTGGGAGGTAGG - Intergenic
917965972 1:180178776-180178798 CAGAATTGTCTCTTGCAGGCTGG + Exonic
921316386 1:213895440-213895462 CAGAGCTGTCACTTGGAGGAGGG - Intergenic
922672380 1:227520650-227520672 CAGGGCTGTCTCTAGGGTGTGGG - Intergenic
924283956 1:242466095-242466117 CAGAATTGTATGTGGGAGGTGGG - Intronic
924808302 1:247379140-247379162 CAGAGTTGGCTTTTGGAGGCAGG - Intergenic
1063733148 10:8722366-8722388 TAGAGTTGTGTCATGGAGGTTGG + Intergenic
1065546214 10:26823824-26823846 CTGAGTTATCTATAGGAGTTTGG - Intronic
1065781112 10:29168635-29168657 CAGAATTGTATCTTGGATGTTGG - Intergenic
1070527365 10:77306787-77306809 CACAGTGCTATCTAGGAGGTAGG + Intronic
1073151040 10:101311590-101311612 CAGAAGTGTCTCTAGGAGGCTGG - Intergenic
1073465365 10:103692177-103692199 GAGAGTGGTCCCTAGGAGTTAGG - Intronic
1075926168 10:126253619-126253641 CAGGGTTTTCTCTGGGGGGTGGG - Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1076199853 10:128549495-128549517 CAAACTGGTATCTAGGAGGTGGG - Intergenic
1076461215 10:130648891-130648913 CAGAGATGTCACCAGGAGGAGGG - Intergenic
1077560617 11:3258030-3258052 CAGAGGTGTCTGTAGGGAGTTGG - Intergenic
1077566514 11:3303858-3303880 CAGAGGTGTCTGTAGGGAGTTGG - Intergenic
1079808796 11:24968918-24968940 CACAGTTGTTTATAGGAGGAGGG + Intronic
1080616531 11:33949414-33949436 CAGAGATGTCTGTCGGAGGGAGG - Intergenic
1083147508 11:60770169-60770191 CAGGGTTGTCTCTGTGAGCTGGG - Intronic
1083257698 11:61506725-61506747 CATAGTTGCCTCTGTGAGGTGGG + Intergenic
1084441924 11:69179471-69179493 CAGAGATGGCTCCAAGAGGTGGG - Intergenic
1085470141 11:76752542-76752564 CAGAGGTGTGTGGAGGAGGTGGG + Intergenic
1087915342 11:103803487-103803509 CTGGGTTCTCTCCAGGAGGTAGG - Intergenic
1088289873 11:108224310-108224332 CAGAGTTATTTCTAGGAAGATGG + Intronic
1089341755 11:117763037-117763059 CAGAGTGGTCTGTGGGAGGAAGG - Intronic
1090335153 11:125957178-125957200 CAAAGTTGCCCCGAGGAGGTGGG + Exonic
1090914864 11:131154465-131154487 GAGATGTGTTTCTAGGAGGTTGG - Intergenic
1094812238 12:34149765-34149787 CAAGGCTGTCTCTAGGATGTGGG + Intergenic
1099744847 12:86689320-86689342 CAGAGTAGTCTTCAGAAGGTGGG - Intronic
1100785228 12:98071440-98071462 CAGAGTTGTCTTTAGAGGCTAGG - Intergenic
1102464279 12:113119418-113119440 CAGAGATGTCTCTGGGAGCCAGG + Exonic
1102505146 12:113379908-113379930 CAGAGTTGTCCCTTGGTGTTGGG + Intronic
1104958930 12:132479028-132479050 CAGAGTGGACTGTAGGAGGCAGG + Intergenic
1106360462 13:29026302-29026324 CACAGTTGTCTCTGGGTGGAGGG - Exonic
1107093934 13:36514753-36514775 CAGAGCTGTGTCTAGGAGCCAGG + Intergenic
1111924906 13:94452516-94452538 CAGAATTGCCTCTAGAAGTTTGG - Intronic
1111927400 13:94478169-94478191 CAGAGCTTTCTCGAGGAGCTGGG - Intronic
1115493087 14:33977716-33977738 CAGAGCTGTCCCTAAGAGTTTGG - Intronic
1116093966 14:40344096-40344118 GAGAGTAGCCTCTAGGATGTAGG - Intergenic
1118522738 14:66604859-66604881 TAGAGTTGTCTAAAGGAGGGAGG - Intronic
1120685588 14:87532786-87532808 CTGAGCTCTCTGTAGGAGGTGGG - Intergenic
1123010161 14:105346112-105346134 CAGAGATGTCTGTAGTAGGCAGG + Intronic
1124018843 15:25901993-25902015 GAGAGTGGCCTCTAGGAGCTTGG + Intergenic
1124063545 15:26318586-26318608 TATAGTTGTCTCTCAGAGGTAGG + Intergenic
1125715676 15:41818658-41818680 CAGTGATGTCTCTGGGAAGTGGG + Intronic
1126215140 15:46146069-46146091 CAGAGTTGGCACCAGGAGTTGGG - Intergenic
1130870164 15:87965176-87965198 CAGTGTTGTCTCTGGGTGATGGG + Intronic
1133022925 16:2974718-2974740 CAGGGCTGCCTCTTGGAGGTGGG + Intronic
1136009511 16:27354131-27354153 AAGAGTTGTTTCTGGGATGTAGG - Intronic
1137285237 16:47010232-47010254 CAGAATGATCTCTAGGAGCTGGG - Intergenic
1137798913 16:51244752-51244774 CAGAGGTGCCGTTAGGAGGTTGG + Intergenic
1139234923 16:65327735-65327757 CAGAATTATTTCTAGGAGATGGG - Intergenic
1140688337 16:77455181-77455203 ATGAGGTGTTTCTAGGAGGTTGG + Intergenic
1142103794 16:88291241-88291263 CAGACTTTTCTGTAGGAGCTTGG + Intergenic
1142787966 17:2239628-2239650 TGGAGTTATCTCTAGGTGGTAGG + Intronic
1146892392 17:36514494-36514516 TCGAGTTTTCTCTAGGAGGTAGG + Exonic
1148218665 17:45847742-45847764 TAGAATTGTCTCAAAGAGGTCGG + Intergenic
1149587963 17:57806093-57806115 AAGAGTTTGCTCTAGGAGGCTGG + Intergenic
1150853589 17:68729333-68729355 CTGAGTTTTCCCTAGGACGTTGG - Intergenic
1152456124 17:80417212-80417234 CACAGTGGGCTGTAGGAGGTGGG - Intronic
1203167398 17_GL000205v2_random:110419-110441 CAGAGCTGTCTCAAGAATGTGGG + Intergenic
1203174000 17_GL000205v2_random:178315-178337 CAGGGCTGTCTCTAGAATGTGGG - Intergenic
1155241115 18:23864642-23864664 AAGGGTTGTATCTAGGAGGTGGG - Intronic
1157742625 18:50106888-50106910 CAGGGTTTTCTTTATGAGGTGGG - Intronic
1161497212 19:4593187-4593209 CAGAGTTGTTTCTAGAAGTTGGG + Intergenic
1163766338 19:19165442-19165464 CTGAGGTGTCTCAGGGAGGTGGG + Intronic
1163889745 19:20000246-20000268 CAGAGTTGTCTCTAGGAGGTGGG - Intronic
1164706306 19:30322821-30322843 CAGAGTGGTCTCCATGAGGCAGG - Intronic
1165892126 19:39119529-39119551 CAGAGTTGCTTCCAGGTGGTGGG + Intergenic
933173796 2:79155435-79155457 CAGATTGGTCTCCAGGAAGTAGG - Intergenic
934660840 2:96142938-96142960 CAGGGTTGTTTCTGGGAGGCTGG - Intergenic
934927841 2:98394069-98394091 CAGAGTTGGCTCCCGGAAGTTGG - Intronic
939855380 2:147352727-147352749 AAGAATTGTTTATAGGAGGTGGG + Intergenic
940325126 2:152417262-152417284 GAGAGGTGTCTGTTGGAGGTTGG + Intronic
942029541 2:171945371-171945393 CAGAGTGTTCTCAAGGATGTAGG + Intronic
942452325 2:176116187-176116209 CCAAGGTGTCTCTAGGAGGGCGG - Intronic
946482000 2:220066217-220066239 CAGAGTGGTCTCTAGGCATTTGG - Intergenic
947453104 2:230226237-230226259 CAGAGTTGTCTTTTGGAGTGGGG - Intronic
948735437 2:240001150-240001172 CACGGTTGTCTTTAGGAGGTGGG + Intronic
1169631599 20:7638592-7638614 CAGAGTAGCTTCTAAGAGGTGGG - Intergenic
1172840229 20:37898413-37898435 CAGGGCTGACCCTAGGAGGTGGG - Intergenic
1173121450 20:40293523-40293545 CAGAGTTGTCTCTGTGAGTCAGG - Intergenic
1173167826 20:40698506-40698528 CAGAGGTGTCTATAGGTGGGGGG - Intergenic
1173925556 20:46778666-46778688 CAGAGCTGACTCCAGGAGGCCGG + Intergenic
1174645939 20:52085383-52085405 AAGTGTTGTCATTAGGAGGTTGG - Intronic
1175874917 20:62224795-62224817 GAGAGTGGTCTCTAGGTGGATGG + Intergenic
1176121347 20:63455838-63455860 CAGAGGGGTCTCCCGGAGGTGGG - Intronic
1176121483 20:63456146-63456168 CAGAGGGGTCTCCCGGAGGTGGG - Intronic
1176329992 21:5539959-5539981 CAGGGCTGTCTCTAGAATGTGGG - Intergenic
1176343984 21:5724141-5724163 CAGAGCTGTCTCAAGAATGTGGG - Intergenic
1176397765 21:6280992-6281014 CAGGGCTGTCTCTAGAATGTGGG + Intergenic
1176404361 21:6348716-6348738 CAGAGCTGTCTCAAGAATGTGGG - Intergenic
1176432796 21:6640388-6640410 CAGAGCTGTCTCAAGAATGTGGG + Intergenic
1176439392 21:6708112-6708134 CAGGGCTGTCTCTAGAATGTGGG - Intergenic
1176463654 21:7035181-7035203 CAGGGCTGTCTCTAGAATGTGGG - Intergenic
1176487215 21:7416960-7416982 CAGGGCTGTCTCTAGAATGTGGG - Intergenic
1176500843 21:7600315-7600337 CAGAGCTGTCTCAAGAATGTGGG + Intergenic
1176538305 21:8122210-8122232 CAGAGCTGTCTCAAGAATGTGGG - Intergenic
1178238147 21:30867856-30867878 TACAGATGTCTCTAGGAGGAAGG - Intergenic
1181763739 22:25076416-25076438 CAAAGTTGTCACTTGGTGGTGGG + Intronic
1181783518 22:25209364-25209386 CAGAGTTGGCTCATGGAGGTGGG - Intergenic
1184032635 22:41903983-41904005 CAGAGTGGGCTCCAGGAGGCAGG - Intronic
1184501745 22:44878818-44878840 CAGAGCTGTCCCTGGGAGGGAGG + Intergenic
1203243252 22_KI270733v1_random:38566-38588 CAGAGCTGTCTCAAGAATGTGGG - Intergenic
949797304 3:7864963-7864985 CAGAGTCGTCTCTGAGAGTTTGG + Intergenic
952483113 3:33782135-33782157 AATAGTTGTCTCTAGGAAGGAGG - Intergenic
953207318 3:40842818-40842840 CAGAGATGGCTCAAGGAGGCAGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
960045765 3:113196355-113196377 CAGAGTTGCCTCTATAAGCTTGG - Intergenic
962256728 3:133875758-133875780 CAGACTTGGCTGTAGCAGGTAGG - Intronic
963776726 3:149447385-149447407 CAGAGTTCTTTCTATTAGGTTGG + Intergenic
967229745 3:187326159-187326181 CAAAATTGTTTCTAGCAGGTAGG + Intergenic
967299744 3:188001073-188001095 CAAAGTTCTCTCTAGATGGTTGG - Intergenic
971509644 4:27408052-27408074 CAGAGATGACTCCAAGAGGTGGG - Intergenic
973637079 4:52870339-52870361 AAGAGTTGTCCCTAGCAGGCCGG - Intergenic
973915089 4:55625673-55625695 AAGAGTTGCCTATAGGAGGGTGG - Intronic
981635760 4:146877205-146877227 CAGTGTTATGTCTGGGAGGTAGG + Intronic
984460942 4:180035837-180035859 CAGGGTTGTCTCCAGGATATGGG - Intergenic
985115768 4:186588951-186588973 CAGGCATGTCTCTAGGAGGGTGG + Exonic
987170144 5:15246954-15246976 CAGAGTTGGCTCTAGGAGCCGGG - Intergenic
988151428 5:27387009-27387031 TAGAATTGTGTCTTGGAGGTAGG - Intergenic
989339519 5:40357677-40357699 CTGAGTTCTGACTAGGAGGTGGG + Intergenic
990342255 5:54834995-54835017 CAGAGTTGCCTTTGGCAGGTAGG + Intergenic
991914135 5:71589090-71589112 TAGAGTTGTATGTAGGAGGGGGG + Intronic
993061716 5:83046690-83046712 AATAATTTTCTCTAGGAGGTGGG - Intergenic
997253324 5:132408297-132408319 CAGAGCTGTCTCCAAAAGGTGGG + Intergenic
998411967 5:141918271-141918293 CAGAGTTGCCTCTAGAGAGTAGG + Intergenic
1001257105 5:170192646-170192668 CAGAGGGGGCTTTAGGAGGTAGG + Intergenic
1002218011 5:177653415-177653437 CTGAGCTGTCTTTGGGAGGTTGG - Intergenic
1002863999 6:1105195-1105217 GAGAGGTGCCTCTAGCAGGTGGG + Intergenic
1004937316 6:20520175-20520197 CAGGGTTGTCTCTGGGAACTGGG + Intergenic
1006288160 6:33113814-33113836 CAGAGTTGTTTGTAGGATGAGGG + Intergenic
1007451379 6:41942004-41942026 CAGAGAACTTTCTAGGAGGTGGG + Intronic
1009055877 6:58334437-58334459 CAGAGTGGTCTGAAGGAGTTTGG - Intergenic
1015087255 6:129310407-129310429 CAGACTTGGATCTAGGAGTTTGG + Intronic
1023063167 7:36348977-36348999 CACACTTCTCTCAAGGAGGTTGG + Intronic
1023164424 7:37329234-37329256 AAGAGTTGTCTATAGGAATTAGG - Intronic
1023855040 7:44177726-44177748 CAGAGTTGTCCCTCTGAGGCAGG - Intronic
1035684551 8:1513550-1513572 CAGTATTGTCTCTGGGAGATGGG - Intronic
1035786395 8:2264514-2264536 CATAGATGTTTCTAGGATGTGGG - Intergenic
1035806412 8:2457202-2457224 CATAGATGTTTCTAGGATGTGGG + Intergenic
1036486900 8:9187765-9187787 AAGAGCTCTCTCTAGGAAGTAGG + Intergenic
1038099194 8:24353250-24353272 CATAGTTTTCTGTAGGAGGTAGG + Intronic
1039301429 8:36213340-36213362 CATCTTTGTCTCTAAGAGGTTGG + Intergenic
1044279468 8:90339123-90339145 CACAGGTGTCTCTAGGAGATGGG - Intergenic
1044646562 8:94449665-94449687 CAGGGCTATTTCTAGGAGGTTGG - Intronic
1044864247 8:96554630-96554652 CAGAGATGGCTCAAGGATGTTGG + Intronic
1045181277 8:99785774-99785796 ATGAGTTCTCTCTAGGTGGTTGG - Intronic
1045412458 8:101932315-101932337 CAGAGTTGTATCTGGGGGTTAGG - Intronic
1047711830 8:127560064-127560086 CAGCGTTGTATCTGGGAAGTGGG + Intergenic
1047801989 8:128319404-128319426 CTCACTTGTCTCTAGGAAGTAGG + Intergenic
1050431688 9:5568722-5568744 CACAGTTGTCTCAGGGAGGGAGG + Intronic
1052180615 9:25522112-25522134 CAACTTTGTCTCTAGGATGTTGG - Intergenic
1053064100 9:35054894-35054916 CAAATTGGTCTCTAAGAGGTAGG + Intergenic
1053089904 9:35265591-35265613 CAAATTTGTCTCTAGGATATGGG + Intronic
1053177913 9:35942690-35942712 AAGAGCTGGCTCTAGAAGGTTGG - Intergenic
1058433786 9:104943078-104943100 CAGAATTATCTCTGGGAAGTGGG - Intergenic
1059171092 9:112125880-112125902 CAGAGTTATTTCCAGGAGGGAGG + Intronic
1059621957 9:116015653-116015675 AAGAGTTGTCACCAGGAGCTGGG - Intergenic
1203432103 Un_GL000195v1:100367-100389 CAGGGCTGTCTCTAGAATGTGGG + Intergenic
1203434396 Un_GL000195v1:124191-124213 CAGGGCTGTCTCTAGAATGTGGG - Intergenic
1203438739 Un_GL000195v1:168282-168304 CAGAGCTGTCTCAAGAATGTGGG - Intergenic
1203459577 Un_GL000220v1:21648-21670 CAGAGCTGTCTCAAGAATGTGGG - Intergenic
1187677065 X:21726754-21726776 CAGAATTGCCTCTGGGAGTTAGG + Intronic
1189224809 X:39403684-39403706 CTGAGCTGTCCCTAGGAGGCTGG - Intergenic
1189667914 X:43377179-43377201 CCAAGTTGTGTCAAGGAGGTTGG + Intergenic
1190795392 X:53736440-53736462 CAGAGATGTCACTAGGCAGTTGG - Intergenic
1192452918 X:71254519-71254541 TAGAGTGGGCTCCAGGAGGTAGG - Intronic
1193659222 X:84236895-84236917 CAGAGTTGTCTATTGGAATTGGG - Intergenic
1198252484 X:134893569-134893591 CAGTGTTAGCTCTAGGAGGGTGG - Intronic
1201757369 Y:17500837-17500859 CAGGGTTGTCTCTAGGATGTAGG + Intergenic
1201844185 Y:18405145-18405167 CAGGGTTGTCTCTAGGATGTAGG - Intergenic