ID: 1163889806

View in Genome Browser
Species Human (GRCh38)
Location 19:20000686-20000708
Sequence GCATAGATCTTCAGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163889806_1163889810 23 Left 1163889806 19:20000686-20000708 CCTTCCTGGCTGAAGATCTATGC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1163889810 19:20000732-20000754 GAAGAGCAAAACTTCAATAGAGG 0: 1
1: 0
2: 3
3: 9
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163889806 Original CRISPR GCATAGATCTTCAGCCAGGA AGG (reversed) Intronic
900479868 1:2892881-2892903 ACATAGATCTTCACTCTGGAAGG + Intergenic
901404213 1:9035376-9035398 GCAAGGATCTGCAGCCTGGAAGG - Exonic
905300184 1:36981654-36981676 GCCTAGATGTTCCTCCAGGAGGG + Intronic
906942093 1:50264415-50264437 GCACAGATATGCAGGCAGGAAGG - Intergenic
911769225 1:101717915-101717937 TCATACATTTTCAGCCAAGATGG - Intergenic
915506999 1:156364113-156364135 GCCTACATGGTCAGCCAGGATGG + Intronic
915550861 1:156633211-156633233 GCAGAGAACTTCAGTCATGAAGG - Intergenic
919139845 1:193557043-193557065 GCCTAGCTCTTCAGCAGGGAAGG - Intergenic
922688160 1:227664218-227664240 CCATAGACCTTCAGCCAGGGAGG + Intronic
1065957906 10:30709415-30709437 GTATAGATCTTCCTGCAGGAAGG - Intergenic
1068669716 10:59710230-59710252 GCATACAGCTCCGGCCAGGAGGG - Intronic
1078010579 11:7570167-7570189 GCATAGATCTTTGGCTAGGTTGG + Intronic
1079329255 11:19520551-19520573 GCATAGAGCTTGGGGCAGGAAGG - Intronic
1084676595 11:70639105-70639127 GCAGAGACCCTCAGCCAGCAGGG - Intronic
1085403390 11:76247700-76247722 GCATAGAGCCTCAGCCTGGAGGG + Intergenic
1086705943 11:89951255-89951277 CTTTAGCTCTTCAGCCAGGAGGG + Intergenic
1087809183 11:102591865-102591887 GCATATACCTTCAGCCAGGCTGG - Intronic
1092998875 12:13977244-13977266 GCATGGATCTTCAGACAGACAGG + Intronic
1103225891 12:119287505-119287527 GGATGGAACTTCATCCAGGAAGG - Intergenic
1106352629 13:28948501-28948523 GCACAGAACTTCAGACAGGCAGG - Intronic
1108083433 13:46760894-46760916 CCAGAGATCTTCAGCATGGATGG - Intergenic
1108470560 13:50762863-50762885 GGAAAGATCTGCATCCAGGAAGG + Intronic
1108604478 13:52023528-52023550 GCAGAGATTGTCAGCCAAGATGG + Intronic
1110400519 13:75085258-75085280 GAATAGACCTATAGCCAGGAAGG + Intergenic
1111949644 13:94700723-94700745 GGATGGATTTTCAGCCTGGAGGG + Intergenic
1119541118 14:75438830-75438852 GCACAGATCCTCAGCCATGCCGG - Intronic
1119639706 14:76305454-76305476 ACATAGACCGCCAGCCAGGAGGG - Intergenic
1121937582 14:98034507-98034529 ACATATTGCTTCAGCCAGGACGG + Intergenic
1124476143 15:30036601-30036623 GCATAAATCTTAAGACAGTATGG + Intergenic
1128263564 15:66250153-66250175 GTGCAGATCTTCTGCCAGGAAGG - Intronic
1135049183 16:19178741-19178763 GCATAAATCTACAGCCATTATGG + Intronic
1135700823 16:24630966-24630988 GCTTAGACATTCAGCCTGGAGGG + Intergenic
1147042148 17:37727345-37727367 CCATTTATCTTCAGCCTGGAAGG - Intronic
1147743174 17:42680094-42680116 GCGCTGCTCTTCAGCCAGGATGG - Exonic
1148606904 17:48936797-48936819 CCAAAGATCTTTGGCCAGGAAGG - Intronic
1151612293 17:75183964-75183986 GGATTGTTCTTCAGACAGGAGGG - Intergenic
1151928677 17:77216652-77216674 GAACAGATCTTCAGCCTGGGAGG - Exonic
1153589229 18:6655549-6655571 GCATGGATCCTCGGCCAGGCAGG + Intergenic
1157402109 18:47397257-47397279 GAATAGATCTGGAGCCAGGGCGG + Intergenic
1159786178 18:72717334-72717356 TCAACCATCTTCAGCCAGGATGG - Intergenic
1161614633 19:5263261-5263283 GCAAACATCCTCAGCCAGGCTGG + Intronic
1162501901 19:11058860-11058882 GCACAGACCTTCAACCTGGAGGG + Exonic
1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG + Intronic
1163231170 19:16003206-16003228 CCAGAGAACTTCAGCCCGGAGGG - Intergenic
1163889806 19:20000686-20000708 GCATAGATCTTCAGCCAGGAAGG - Intronic
1164896005 19:31878354-31878376 GCATAGATCTGTAACCAGCAAGG + Intergenic
1168215681 19:54923858-54923880 TCATAGGTCTTCAACCTGGAGGG + Exonic
925646611 2:6043435-6043457 GCTTGGAACTTCAGCCAGGCAGG + Intergenic
927481647 2:23458594-23458616 TCATAGCTCTACAGCCAGGATGG + Intronic
930210813 2:48635121-48635143 GCAGAGATCTTGATGCAGGAAGG - Intronic
931009541 2:57893306-57893328 GTATAGATCTTCACCAAAGAAGG + Intergenic
932751077 2:74372134-74372156 GCATAGACCTGGAGCAAGGATGG - Intronic
935418435 2:102842692-102842714 GCAAAGATATGCAGCAAGGAAGG - Intronic
1170437540 20:16345978-16346000 GCAGAGCTCTGCAGCCAGGTGGG + Intronic
1172110814 20:32543961-32543983 GCAAAGGTCTTCAGGCAGGCAGG + Intronic
1173956950 20:47040750-47040772 GCATTGACTTTCAGCCAGAAAGG - Intronic
1174379620 20:50148289-50148311 GCATGGATCATCAGCCTGGCAGG + Intronic
1175030962 20:55953545-55953567 GCAAAAATCTTAAGGCAGGAAGG + Intergenic
1175127034 20:56760098-56760120 GCACAGACCTCCAGCCAGGGTGG + Intergenic
1176163303 20:63659539-63659561 GGGTGGAGCTTCAGCCAGGACGG + Intronic
949632636 3:5944699-5944721 CCAGAGATCTTCATCCACGATGG - Intergenic
952301869 3:32110577-32110599 CCAGGGAGCTTCAGCCAGGAAGG + Intronic
952527379 3:34224683-34224705 GCACAAACCTTCAGCCAGGGAGG + Intergenic
957265784 3:77963553-77963575 GTATAGACATTCAGCCATGAGGG - Intergenic
960258531 3:115537472-115537494 GTATAGGTCTACAGCCAGGATGG - Intergenic
961329651 3:126131030-126131052 GCAGGGACCTGCAGCCAGGAAGG + Intronic
963769963 3:149379377-149379399 GGATAGATCAGCAGACAGGAGGG - Intergenic
966547268 3:181163974-181163996 ACATAGATCTTTCTCCAGGATGG - Intergenic
966660244 3:182406519-182406541 GCATAAACCTTCAGACAGAAGGG + Intergenic
967533635 3:190577530-190577552 GCATGTATCTTCTGCCAGAAAGG - Intronic
968821046 4:2851678-2851700 ACATAGGGCTTCAGGCAGGAAGG + Intronic
972336312 4:38109895-38109917 TCCCAGATCTTCATCCAGGAAGG + Intronic
976614386 4:87061303-87061325 GAATAGGTCCTCAGCCTGGAGGG - Intronic
976633791 4:87266907-87266929 CCATAGATCTTCATCAAGAAAGG + Intergenic
978485905 4:109253269-109253291 TCCAAGATCTTCAGCCAGCAAGG + Intronic
980688394 4:136260299-136260321 CCATAGATCTTCAGACTGGCAGG + Intergenic
982473777 4:155825862-155825884 GCACATATCCTCAGTCAGGAAGG - Intergenic
986824377 5:11504858-11504880 GCAGGAATCTTCAGCAAGGAAGG - Intronic
988048748 5:25995403-25995425 CCATAGACTTTCAACCAGGAAGG + Intergenic
989148237 5:38270005-38270027 GTCTAGCTCTGCAGCCAGGAGGG + Intronic
989640017 5:43575143-43575165 GGTAAGATCTTCAGCCATGAAGG - Intergenic
991231930 5:64343883-64343905 GCACAGAACTTTAGCAAGGAAGG + Intronic
992359839 5:76025943-76025965 GCAGTGATTTTCAACCAGGATGG + Intergenic
995140366 5:108728406-108728428 GCATGAATCTTCAGCCTGGGAGG + Intergenic
998070005 5:139190396-139190418 GCAAAAATCTTCAACCATGAGGG + Intronic
998909216 5:146940249-146940271 GCCTGAATCTGCAGCCAGGAGGG - Intronic
999585982 5:153090004-153090026 GAATAGTTCTGCAGCCAGGTAGG - Intergenic
1000218988 5:159193370-159193392 GCATAGAAAATCAACCAGGAAGG + Intronic
1001879845 5:175233871-175233893 ACAAAGGTCTTCAGACAGGATGG + Intergenic
1002802872 6:542909-542931 GCTTAGCTCTTCAGGCAGTACGG + Intronic
1003464837 6:6369028-6369050 GCATGGATCTTCTGACAGTAGGG - Intergenic
1005831517 6:29674855-29674877 ACTTAGATCTTCAGCCAGCCAGG + Intronic
1005994775 6:30924460-30924482 CCAGAGCTCTTCAGCCAGGAAGG - Exonic
1009913675 6:69965854-69965876 GCATAGCTCATGAGGCAGGAGGG + Intronic
1012493542 6:99809683-99809705 GCATAGCTCTTCAGTAAGAACGG + Intergenic
1021699924 7:23308169-23308191 GTATATATCTTCCTCCAGGAGGG - Intronic
1021801225 7:24308869-24308891 GCATTGAGCGTGAGCCAGGAGGG - Intergenic
1028092764 7:86723870-86723892 GCATTGTGCTTCAGCCAGGAGGG - Intronic
1035600364 8:893682-893704 GGATAGACCTGCAGGCAGGAGGG - Intergenic
1035608496 8:945278-945300 GCATAGATCCACTCCCAGGAGGG - Intergenic
1037155011 8:15689228-15689250 GCATATATTTTCAGGCTGGATGG + Intronic
1037479529 8:19291268-19291290 GCATAGATTTACATCCATGAAGG + Intergenic
1038514740 8:28177364-28177386 TCATTGATCTCCTGCCAGGATGG - Intronic
1041211462 8:55555665-55555687 GCATGGAGCTTCAGCCAGAGTGG + Intergenic
1042069692 8:64917565-64917587 GTGTAGATCTTCAACCTGGAGGG - Intergenic
1045998815 8:108395491-108395513 GCATAGTTCTACAGCCAAGACGG - Intronic
1046771377 8:118119797-118119819 GCAAAGATCTTAAGGCAGAAAGG + Intergenic
1047339537 8:123967386-123967408 GAAAAACTCTTCAGCCAGGAAGG - Intronic
1052856193 9:33408116-33408138 GCATTAAGCTTCAGCCAGGAAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058720628 9:107760585-107760607 CCATAGTTCCTCAGGCAGGAAGG - Intergenic
1059655563 9:116354479-116354501 GCAAGGATCATCAGCCAGGTGGG + Intronic
1061296348 9:129678976-129678998 GCCCAGATCCTCAGCCAGGGAGG + Intronic
1062521281 9:136959016-136959038 GAAAGGGTCTTCAGCCAGGAAGG - Intergenic
1191956133 X:66644250-66644272 GAATAGCTCTTCAGAGAGGATGG - Intergenic
1197214336 X:123854091-123854113 GGAGAGATCATCATCCAGGATGG - Intergenic
1198175332 X:134149089-134149111 GCATAGATCCACAGACAGGTTGG + Intergenic
1199158877 X:144584684-144584706 GCATAAATCTTTAGCAAGGCTGG + Intergenic