ID: 1163900769

View in Genome Browser
Species Human (GRCh38)
Location 19:20098067-20098089
Sequence ATATAAGTAGACAGCTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 11, 2: 46, 3: 114, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163900769 Original CRISPR ATATAAGTAGACAGCTTATT TGG (reversed) Intronic
901410054 1:9076678-9076700 ATACAAGTAGAGAGTTTATTTGG + Intronic
903089396 1:20897713-20897735 TAAAAAGTAGACAGCTTATTGGG + Intronic
904175066 1:28621734-28621756 ATATAAGTAGAGAGTTTATTTGG - Intronic
904475301 1:30761012-30761034 ATATAAATAGTGAGCTTATGTGG - Intergenic
906742646 1:48197618-48197640 ATATAAGTAGAGAGTTTACTGGG + Intergenic
908328012 1:63042884-63042906 ATCTAAGTAGAGAGTTTATTTGG + Intergenic
908917210 1:69142626-69142648 ATATAAGTTTTCAGCTTCTTTGG - Intergenic
909651585 1:77981680-77981702 ATATAAATAAACTGCTTTTTAGG + Intronic
909710602 1:78645327-78645349 ATATAAGTAGAGAGTTTATTTGG - Exonic
911537895 1:99122522-99122544 ATGTAAGCAGAGAGTTTATTTGG - Intergenic
912056630 1:105607620-105607642 ATATATAAATACAGCTTATTTGG + Intergenic
912140797 1:106724201-106724223 ATATAAATTCACAGCTTAGTGGG - Intergenic
912358874 1:109078015-109078037 ATATAAATAGAGAGTTTATTTGG - Intergenic
912859625 1:113202038-113202060 GTGTAAGTAGAGAGTTTATTTGG - Intergenic
916255784 1:162786748-162786770 ATATGAGTTGACTGTTTATTGGG + Exonic
916393709 1:164361871-164361893 CTATAAGCAGACTGCTTAGTAGG + Intergenic
916810530 1:168301618-168301640 ATATAAGTAAAAAGTTTATTTGG + Intronic
919067343 1:192709548-192709570 CTATTAGTTGACAGCTTAATTGG - Intergenic
919185683 1:194145499-194145521 ATATGAGTATACAGTTTCTTTGG - Intergenic
919936314 1:202253038-202253060 CTAAAAGTAGACAGATTATTTGG - Intronic
920163207 1:204015820-204015842 ATATAAGCAGAGAGTTTATTTGG + Intergenic
922813556 1:228432728-228432750 ATAAAAGGTGAGAGCTTATTTGG - Intergenic
923466808 1:234255509-234255531 ATATAAGTTTTCAGCTCATTTGG - Intronic
924286068 1:242488226-242488248 ATATAAGTTTTCAGCTCATTTGG - Intronic
924511988 1:244735341-244735363 ATATAAGTAGAGAGCTGATTTGG - Intergenic
1062785799 10:263687-263709 ATATAAGTAGGCAGTTTATTTGG + Intergenic
1062871713 10:910315-910337 ATATAAGTAGAGAGTTGATTTGG - Intronic
1064700662 10:18017096-18017118 ATATAAGTAAATAATTTATTTGG - Intronic
1066222429 10:33348117-33348139 TTATTTGTACACAGCTTATTTGG + Intergenic
1066722247 10:38352417-38352439 ATATGAGTTGACTGTTTATTGGG + Intergenic
1066975055 10:42360393-42360415 ATTTAAGTAGAGAGTTTATTTGG + Intergenic
1067823589 10:49552050-49552072 ATATAAGTAGAGAGTTTATGTGG + Intergenic
1068138002 10:52969987-52970009 ATATAAGCAGAGAGTTTATTTGG - Intergenic
1068155692 10:53194988-53195010 GTATAAGCAGACAACTTCTTGGG + Intergenic
1068472090 10:57478351-57478373 ATATAAGTGCAGAGCTTATTTGG + Intergenic
1068606768 10:59014005-59014027 ATATAAGTAGAGAATTAATTTGG + Intergenic
1070860660 10:79657062-79657084 ATAAAAGAAGACAGCCAATTGGG + Intergenic
1070876603 10:79818502-79818524 ATAAAAGAAGACAGCCAATTGGG - Intergenic
1077885907 11:6387611-6387633 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1078044048 11:7896986-7897008 ATATAAGCAGAGAGTTTATTTGG + Intergenic
1078045292 11:7908630-7908652 ATGTAAGTAGAGAGTTCATTTGG - Intergenic
1078408439 11:11091729-11091751 ATATAGGTAGAGAGTTTATTTGG - Intergenic
1078814643 11:14807498-14807520 ATATAACTAAAAAGCTTATAAGG + Intronic
1079019197 11:16895172-16895194 ATATAAGAAGCTATCTTATTAGG + Intronic
1079194610 11:18314648-18314670 ATATAAGCAGACAGTTTATTAGG - Intronic
1080368097 11:31601062-31601084 CAATAACTAGTCAGCTTATTAGG - Intronic
1081090033 11:38853070-38853092 ATGTAAGTAGAGGGCTTATAAGG + Intergenic
1083604330 11:63968729-63968751 ACATAAGCAGAGAGCTTATTTGG - Intergenic
1085226541 11:74926402-74926424 ATTTAAGTTAACAGCTTTTTGGG + Intronic
1086913594 11:92501458-92501480 CTATTAATAGACAGCCTATTAGG - Intronic
1087767972 11:102176995-102177017 CTATATGTAGACAAGTTATTAGG + Intronic
1088329917 11:108640782-108640804 ATATAAGTAGAGAGTTTATTTGG + Intergenic
1089217508 11:116843744-116843766 AGATAAGTCAACAGCTTTTTAGG + Intronic
1089543016 11:119202021-119202043 ATTTAAGTAGAGAGTTTACTTGG + Intergenic
1091522919 12:1266035-1266057 ATATAAGTTTTCAGCTCATTTGG + Intronic
1092946896 12:13464936-13464958 ATTTAAGTAAACAGACTATTAGG - Intergenic
1092969934 12:13683765-13683787 ATATATGTTGAGAGCTTGTTTGG - Intronic
1093355001 12:18156011-18156033 ATATAAATAGAGATTTTATTAGG - Intronic
1093574233 12:20708242-20708264 ATAAAACTAAACAGCCTATTAGG - Intronic
1093826142 12:23691619-23691641 AAATAAGTAGACAAATTATTAGG - Intronic
1094737557 12:33252246-33252268 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1097447563 12:59691216-59691238 ATATACATAGAAAGTTTATTTGG + Intronic
1097765349 12:63520274-63520296 ATTGAAGTAGACACTTTATTCGG + Intergenic
1098440239 12:70510104-70510126 ACATAAGGAGAGAGTTTATTTGG - Intergenic
1098773204 12:74581162-74581184 ATATAAGTAGAGAGTTAATTTGG - Intergenic
1099102549 12:78460151-78460173 ATATAAATAGAGAGTTTATTTGG + Intergenic
1099121495 12:78695214-78695236 TTATGAGTAGAGAGTTTATTTGG - Intergenic
1099666892 12:85642543-85642565 ATATAGGTAGAGAGTTTATTTGG + Intergenic
1099854250 12:88143097-88143119 ATTTAAGTCTACAGCTTCTTAGG - Intronic
1099947148 12:89257745-89257767 ATATAAGTAGACAGTTTATTTGG + Intergenic
1100261939 12:92940738-92940760 ATGTAAGTAGAGAGTTTATTTGG + Intergenic
1100499676 12:95161586-95161608 ATGTAAGTAGAGAGTTTATTTGG - Intronic
1101720311 12:107345261-107345283 AAATAAGTAGACACCTTGATGGG + Intronic
1103081828 12:118030266-118030288 ATTTAAGTAGACAGAGCATTGGG + Intronic
1104824184 12:131696693-131696715 ATACAAGTAGAGAGTTTATTTGG + Intergenic
1105230473 13:18490389-18490411 ATTTAAGTAGAGAGTTTATTTGG + Intergenic
1105369952 13:19793630-19793652 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1105385026 13:19921809-19921831 ATATAAGTGGAGAGTTTATTTGG + Intergenic
1108677978 13:52754174-52754196 ATCTGAGAAGCCAGCTTATTAGG - Intergenic
1108910749 13:55548645-55548667 ATACAGGTAGAGAGCTTATTTGG + Intergenic
1109219441 13:59626413-59626435 AAATAAGGAGACAGATTAATAGG - Intergenic
1109561597 13:64056844-64056866 ATATAAGTAAAGAGTTTATTTGG + Intergenic
1109602291 13:64647566-64647588 ATATAAGTTGTCAACTCATTTGG - Intergenic
1110529307 13:76577900-76577922 TTATAAGTAAAAAGTTTATTTGG - Intergenic
1110658815 13:78033781-78033803 ATATAAGTTTTCAACTTATTTGG - Intergenic
1111768903 13:92571468-92571490 ATATAATTAATCAGGTTATTGGG - Intronic
1112400638 13:99074799-99074821 ACGTAAGTAGAGAGTTTATTTGG - Intronic
1112900916 13:104355734-104355756 ATATAAGTAGAGACGTTTTTAGG + Intergenic
1113159455 13:107363435-107363457 ATAAAAGTAAAAAGATTATTGGG + Intronic
1113262047 13:108575593-108575615 ATTTCAGTAGAGAGTTTATTAGG - Intergenic
1114014728 14:18417204-18417226 GTTTAAGTAGAGAGTTTATTTGG + Intergenic
1115290711 14:31768939-31768961 ATATAAGTAGAGAGTTTATTTGG + Intronic
1115826829 14:37288018-37288040 ATATAAGTAGAGAGTTTATTGGG + Intronic
1116523181 14:45873610-45873632 ACATAAATAGAGAGTTTATTTGG - Intergenic
1116820099 14:49619660-49619682 ATATAAGTAGAATGTTTATTTGG + Intronic
1116848368 14:49885235-49885257 ATATAAGTAGAGAGTGTACTTGG - Intergenic
1117871468 14:60205343-60205365 ATAAAAGGAGAAAGCTTTTTAGG + Intergenic
1118354358 14:65000405-65000427 ATGTAAGTAGAGAGTTTATTTGG + Intronic
1118620899 14:67613047-67613069 ATATAACTAGAGAATTTATTTGG + Intergenic
1119272911 14:73325583-73325605 ATGTAAGTAGAAGGTTTATTTGG - Intronic
1120606667 14:86587010-86587032 ATAAAAATATTCAGCTTATTAGG + Intergenic
1122465315 14:101929586-101929608 ATACAGGGAGAGAGCTTATTTGG + Intergenic
1122653576 14:103241269-103241291 ACATAAATAGAGAGTTTATTTGG + Intergenic
1124078757 15:26471433-26471455 ATAAAAGTAGAGAGTTTATTTGG + Intergenic
1124078904 15:26473026-26473048 ATGTAAGTAGAGAGTTTATTTGG + Intergenic
1124530199 15:30499125-30499147 ATATAAGTAGAGAGTTTATATGG + Intergenic
1124768460 15:32508563-32508585 ATATAAGTAGAGAGTTTATATGG - Intergenic
1125408572 15:39380676-39380698 ATCTAAGAATACAGCTAATTAGG + Intergenic
1125660427 15:41390260-41390282 ATATAAGTAGACAACAATTTTGG - Intronic
1126219074 15:46191399-46191421 ATATAAGTAGAGCGTTTTTTGGG - Intergenic
1126568540 15:50125932-50125954 ATATAACTAGAGGGTTTATTTGG - Intronic
1127233110 15:57018111-57018133 ATGTAAGTAGAGAGCGTATTGGG + Intronic
1128304704 15:66590454-66590476 ATGTAAGTAGACAGTTTATTTGG - Intronic
1128341940 15:66828491-66828513 ATATAAATAGAGAGTTTATCTGG - Intergenic
1129781629 15:78276168-78276190 GTATAAGAAAACAGCTTAATAGG + Intronic
1130774489 15:86964574-86964596 ATTAATGTAGACAGCTTAGTGGG + Intronic
1130836636 15:87656203-87656225 ATATAAGTAAAGAGTTTATTTGG + Intergenic
1130837027 15:87661321-87661343 ATGTAAATAGAGAGTTTATTTGG + Intergenic
1131163163 15:90122579-90122601 ATACAAATAGAGAGTTTATTTGG - Intergenic
1131192109 15:90325111-90325133 ATATAAGTAGAGAATTTATCTGG - Intergenic
1135179706 16:20262092-20262114 TAATAAGAAGACAGCTTACTAGG + Intergenic
1135556429 16:23440780-23440802 AAATAAGTAGAGAGTTTATTTGG + Intronic
1135786385 16:25352883-25352905 ATATATGTAGGCTGCTGATTTGG + Intergenic
1137849778 16:51730178-51730200 ATATACGTAGACATTTGATTTGG + Intergenic
1140800277 16:78481188-78481210 AAATAAGTAGACATCTTTTGAGG + Intronic
1141118149 16:81329366-81329388 ATATAAGTAGAGAGTTTATTTGG - Intronic
1141486328 16:84342649-84342671 AATTAAGTAGAGAGTTTATTTGG + Intergenic
1144926491 17:18814724-18814746 ATAGAAGTAGGCAGATGATTAGG + Intergenic
1148627802 17:49083538-49083560 ATATAAGTAGAGAGTGTATTTGG + Intergenic
1150921933 17:69493149-69493171 AAACAAGTAGACAGATTAATAGG + Intronic
1153419573 18:4889367-4889389 GTATCAGTAGAGAGTTTATTTGG - Intergenic
1153656338 18:7285887-7285909 ATATAAGTAGAGAGTTTATATGG + Intergenic
1153705444 18:7740308-7740330 ACATAAGTAAAGAGTTTATTGGG + Intronic
1153832870 18:8938649-8938671 ATATAAGTAGAGAGTTTATTGGG - Intergenic
1154522931 18:15249480-15249502 ATTTAAGTAGAGAGTTTATTTGG - Intergenic
1155743967 18:29327040-29327062 ATATAAGTAGAGATTTTACTTGG + Intergenic
1155970856 18:32082403-32082425 ATATAAGTAGAGAGTTTATTTGG + Intergenic
1156907534 18:42371732-42371754 ATGTAAGTAGAGAGTTTATTTGG - Intergenic
1158128966 18:54131698-54131720 ATAAAAGTAGAGAGTTTATTTGG - Intergenic
1158166325 18:54545243-54545265 AAATAAGTAGAGAGTTTATTTGG + Intergenic
1159253335 18:65910206-65910228 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1160548497 18:79678541-79678563 CTCTAAGTAGAGAGTTTATTTGG - Intergenic
1163874433 19:19855190-19855212 ATATAAGTAGACAGTTTATTTGG + Intergenic
1163876351 19:19872769-19872791 ATATAAGTAGACAGTTTATTTGG - Intronic
1163879954 19:19910613-19910635 ATATAAGTAGATAGTTTACTTGG - Intronic
1163900769 19:20098067-20098089 ATATAAGTAGACAGCTTATTTGG - Intronic
1163909860 19:20179444-20179466 ATATAAGTAGACAGTTTATTTGG - Intronic
1163913806 19:20220454-20220476 ATGTAAGTAGACAGTTTATTTGG + Intergenic
1163926544 19:20350043-20350065 ATGTAAGTAGACAGTTTATTTGG + Intergenic
1163930358 19:20384573-20384595 ATATAAGTAGACAGTTTATTTGG - Intergenic
1163932915 19:20415027-20415049 ATATAAGTAGACAGTTTATTTGG + Intergenic
1163936066 19:20445259-20445281 ATATAAGTAGACAGTTTATTTGG - Intergenic
1163956999 19:20652329-20652351 ATATAAGTAGACAGTTTATTTGG + Intronic
1163970313 19:20787281-20787303 ACATAAGTAGACAGTTTATTTGG - Intronic
1164007067 19:21159944-21159966 ATATAAGTAGAGAGTTCATTTGG - Intronic
1164021945 19:21315535-21315557 ATGTAAGTATACAATTTATTTGG + Intronic
1164044433 19:21523755-21523777 ACAGAAGTAGGCAGTTTATTTGG - Intronic
1164069109 19:21750070-21750092 ATATAAGTAGAGAGTTCATCTGG + Intronic
1164094657 19:21996153-21996175 ACATAAGCAGACAGTTTATTTGG + Intronic
1164114222 19:22201615-22201637 ACATAAGCAGACAGTTTATTTGG + Intergenic
1164124624 19:22301337-22301359 ATTTAAGTTGACAGTTTATTTGG - Intronic
1164140709 19:22459709-22459731 ATATATGTAGACAGTTTATTTGG - Intronic
1164175697 19:22772072-22772094 ATATAAGTTGACCGTTTATTTGG + Intronic
1164183699 19:22842609-22842631 ATGTAAGTAGACCGTTTATTTGG - Intergenic
1164198364 19:22993490-22993512 ACATAAGCAGACAGTTTATTTGG + Intronic
1164284574 19:23801846-23801868 ATATAAGTACACAGTTTATTGGG - Intronic
1164317113 19:24100790-24100812 ATATAAGTAGACAGTTTATTTGG - Intronic
1166940234 19:46358601-46358623 ATATAAGTAGAGATTTTATTTGG + Intronic
926490421 2:13519496-13519518 ATGTAAGTAGAGAGTTTATTTGG + Intergenic
927950135 2:27162169-27162191 ATACAAGTAGAGAGTTTATTTGG + Intergenic
928651490 2:33408349-33408371 ATGTAAGTTTTCAGCTTATTTGG + Intergenic
928987315 2:37194423-37194445 ATCAAAGTACAGAGCTTATTTGG + Intronic
929323351 2:40574250-40574272 ATGCAAGTAGACAACTTATATGG - Intronic
930623416 2:53668304-53668326 TAATAAGTAGACAGTTTATTTGG - Intronic
930756357 2:54977534-54977556 AAATTATTAGACAGCTTTTTGGG + Intronic
931034472 2:58222747-58222769 ACCTAGATAGACAGCTTATTTGG + Intronic
931445406 2:62323137-62323159 ATGAATGTAGACAGTTTATTTGG - Intergenic
933127846 2:78633608-78633630 ATATAAATAAACAGGTTATTTGG - Intergenic
933164939 2:79065512-79065534 CTATCAGAGGACAGCTTATTTGG - Intergenic
933273505 2:80259200-80259222 ATGTAATTAGACAGCCCATTTGG + Intronic
935163012 2:100545566-100545588 ACATAAGCAGGCAGTTTATTTGG + Intergenic
935377631 2:102416175-102416197 ATATAAGTAAAGACTTTATTTGG - Intergenic
936157199 2:110055791-110055813 ACATAAGAAGACCGTTTATTTGG + Intergenic
936187495 2:110315653-110315675 ACATAAGAAGACCGTTTATTTGG - Intergenic
936853050 2:116924696-116924718 AGCTAAGTACACAGGTTATTTGG + Intergenic
937667758 2:124506072-124506094 ATATAAGTAGATAGTTTATTTGG + Intronic
937670373 2:124531840-124531862 ATATAAGTAGAGAGTTCATTTGG + Intronic
938522220 2:132082326-132082348 ATTTAAGTAGAGAGTTTATTTGG - Intergenic
938708271 2:133952906-133952928 ATGTAAGTAAAGAGTTTATTTGG - Intergenic
939090349 2:137773111-137773133 ATATGAGTAAAGAGTTTATTGGG + Intergenic
939362378 2:141189590-141189612 ATCTAAGTAGAGAGTTTATTGGG - Intronic
941124876 2:161572577-161572599 ATAGAAGTGGAGAGCATATTAGG - Intronic
941400487 2:165023971-165023993 AAATAAGTAAAAAGCATATTGGG + Intergenic
941760034 2:169232162-169232184 AGGTAAGGAGACAGATTATTTGG - Intronic
941837046 2:170034656-170034678 ATATAAGTTTTCAGCTTTTTTGG + Intronic
941998043 2:171620108-171620130 ACATAAGTAGAGGGTTTATTTGG + Intergenic
944273820 2:197812945-197812967 CTTTAAGTATACAGGTTATTTGG - Intronic
947238039 2:227964327-227964349 ATATAAGTAGAGGGTTTATTTGG + Intergenic
948015396 2:234686094-234686116 ATAAAAGTAGAGAGTTTATTTGG + Intergenic
948434349 2:237943203-237943225 GTATAATTAGAGAGTTTATTTGG + Intergenic
1168943691 20:1734087-1734109 ATATAAGTAGAAGGTCTATTTGG - Intergenic
1169765178 20:9140964-9140986 ATATAAGGACATAGTTTATTGGG + Intronic
1169906215 20:10607386-10607408 ATCTAAGTAGAAAGATTAGTGGG + Intronic
1169917880 20:10701573-10701595 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1173466192 20:43283442-43283464 AAATAAATAGACAGTGTATTGGG - Intergenic
1176419103 21:6499678-6499700 ATATAAGTAGAGAGGTTATTTGG + Intergenic
1176774462 21:13118736-13118758 ATTTAAGTAGAGAATTTATTTGG + Intergenic
1177190043 21:17840668-17840690 ATATAAGTAGAGAATTTATTTGG + Intergenic
1177361298 21:20075871-20075893 ATATAAGGAGATAACCTATTGGG + Intergenic
1177513413 21:22119431-22119453 ATACAAGTAGAAAGCTTAAGTGG - Intergenic
1178187155 21:30236137-30236159 ATATAAGTAGAGAGTTTATTTGG + Intergenic
1179694596 21:43108000-43108022 ATATAAGTAGAGAGGTTATTTGG + Intergenic
1179720183 21:43311906-43311928 ATCTAAGTGGAGAGTTTATTTGG + Intergenic
1179806000 21:43837511-43837533 ATATAAGTTTTCAGCTCATTTGG - Intergenic
1180439228 22:15348011-15348033 GTTTAAGTAGAGAGTTTATTTGG + Intergenic
1180522083 22:16218451-16218473 ATTTAAGAAGAGAGTTTATTTGG + Intergenic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
949991645 3:9584158-9584180 ATATAAGTACAGAGTTTATTTGG + Intergenic
949996495 3:9621395-9621417 GTATAAGTAGAAAGGTTATTTGG + Intergenic
950780273 3:15385811-15385833 ATGTAAGCAGAGAGTTTATTTGG - Intronic
952535132 3:34301195-34301217 ATATAAGTAGGGGGTTTATTTGG - Intergenic
953069729 3:39507064-39507086 ATATAAGCAGAGAGCTCAGTAGG - Intronic
954261355 3:49441276-49441298 ATATAAGTAGAGAGTTTATTTGG + Intergenic
955985607 3:64571055-64571077 ATATTAAGAGACAGCTTGTTTGG - Intronic
956120582 3:65962066-65962088 AGATAAGAAGAAAGCATATTTGG + Intronic
957382211 3:79446555-79446577 AAATAATTTGACAGCTTAGTGGG - Intronic
957564071 3:81862755-81862777 ATATAAGTTGAGAGTTTATTTGG + Intergenic
957983445 3:87542274-87542296 ATATAAGTAGAGAGTTTATTCGG - Intergenic
959150275 3:102599614-102599636 ATAAAAATAGAGAGTTTATTTGG + Intergenic
959192104 3:103127303-103127325 ATCTAAGAACACAGCTTATACGG + Intergenic
960221179 3:115110390-115110412 CTATAAGCCTACAGCTTATTGGG - Intronic
960389474 3:117059033-117059055 ATATAAGTAGAGAGTTTATTTGG - Intronic
960522815 3:118675250-118675272 ATATAAGGAGACTGATTATAGGG - Intergenic
962749044 3:138419517-138419539 ATATAAGTAGAGAGTGTATTTGG + Intergenic
962749590 3:138424109-138424131 ATATAAGTAGAGAGTTATTTGGG - Intergenic
963151238 3:142047602-142047624 ATATAAGTGGAGAGTTTATTTGG - Intronic
963877186 3:150489574-150489596 TTATAAGTAGAGAGTTTATTTGG - Intergenic
963933618 3:151029633-151029655 ATGTAAGTTGACAGCTTTCTGGG + Intergenic
964074243 3:152673969-152673991 AGATAAGATGACATCTTATTAGG - Intergenic
965231475 3:166059270-166059292 CTCTAAGTACACAGCTTTTTTGG + Intergenic
965281329 3:166757818-166757840 ATATATGTAGATAGATTATTAGG - Intergenic
965830403 3:172780006-172780028 TTTTAAGTAGACATCTTATTTGG - Intronic
966356218 3:179081838-179081860 ATATAAGTAGAGAGTTTAATTGG + Intergenic
968178696 3:196573582-196573604 ACATAGGTAGACAGCTGACTGGG + Intronic
968384994 4:127972-127994 ATATAAGTAGAGAGTTTTCTGGG - Intronic
968393947 4:215847-215869 AAATAAGTAGAGAGTTTATTTGG - Intergenic
968401195 4:299247-299269 ACACAAGTAGAAAGTTTATTTGG + Intronic
968406157 4:341004-341026 ATATAAGAAGAGAGTTTATTTGG - Intronic
968410979 4:389679-389701 ACATAACTAGAGAGTTTATTTGG - Intergenic
969047573 4:4347860-4347882 ATTTAAGTACAAAGTTTATTTGG + Intergenic
970947007 4:21706246-21706268 ATATAAGTGAACAGCTCATAAGG + Intronic
970986824 4:22168655-22168677 ATTTAAGTGCAAAGCTTATTAGG - Intergenic
971603680 4:28629718-28629740 ATATAAGGAGACATCTTTTTTGG + Intergenic
971669982 4:29544006-29544028 ACAAAACTAGACAGCTTATCTGG + Intergenic
971727903 4:30337021-30337043 ATAGATGTAGAGAGTTTATTTGG - Intergenic
973047433 4:45552108-45552130 ATATATGTATATATCTTATTTGG - Intergenic
973829992 4:54749039-54749061 ATATAAGCAGAGAGTTTATTTGG - Intergenic
974314385 4:60258890-60258912 GTATAAGTAATCAGATTATTGGG - Intergenic
976446556 4:85136602-85136624 ATATATGTAAACATCTAATTTGG + Intergenic
977746897 4:100559518-100559540 ATGGAAGTAGACAGCTTAAAGGG + Intronic
978350614 4:107817020-107817042 ATATAAGTGGAGAGTTTATTTGG + Intergenic
979091170 4:116484415-116484437 ATATAGGTCAACAGTTTATTGGG + Intergenic
979541326 4:121886823-121886845 ATATAAGTAGAGAGTTTATCTGG + Intronic
979563915 4:122132783-122132805 ATGTAAGTAGGGAGTTTATTTGG + Intergenic
979736243 4:124089240-124089262 TTATGAGTAGACACTTTATTGGG + Intergenic
981572990 4:146173495-146173517 AAATAAGTTTTCAGCTTATTTGG - Intergenic
983705617 4:170654912-170654934 ATATAAGTAGAGAGTTTATTTGG - Intergenic
985094168 4:186396192-186396214 ATAGAAGAAGACAGCAAATTTGG - Intergenic
987393785 5:17401801-17401823 ACATAAGTAGAGAGTTGATTCGG - Intergenic
988129663 5:27086397-27086419 TTATCAGTAGACAGGTAATTAGG - Intronic
988287508 5:29239250-29239272 ATACAAGTATAGAGTTTATTTGG + Intergenic
988775659 5:34476019-34476041 ACATAAGTAGAGAGTTTATTTGG + Intergenic
989090284 5:37723436-37723458 GTATGAGTAGAAAGCTTACTAGG + Intronic
989267770 5:39497437-39497459 ACATAAGTAAATAGTTTATTTGG - Intergenic
989603787 5:43224592-43224614 ATATAAGTAGAGGGTTCATTTGG + Intronic
990258576 5:53997199-53997221 AAAGAAGAAGACAGATTATTTGG - Intronic
990337776 5:54792121-54792143 ATATAACTAGTAAGCTTATAGGG - Intergenic
992262443 5:74984857-74984879 ATATAGGTAGAGAGTTTATTTGG + Intergenic
992332086 5:75727887-75727909 ATATAAGTAGAGAGTTAATTTGG + Intergenic
992399181 5:76395994-76396016 ATATAAGCAGAGAGTTTATTTGG + Intergenic
992434384 5:76741160-76741182 ATATAAGTAGAGAGTTTATTTGG - Intergenic
992721687 5:79567288-79567310 ATATAAGTAGAAAGTTTATTTGG + Intergenic
992722708 5:79576564-79576586 ATATAAGTAGAGAGTTGATTTGG + Intergenic
992781537 5:80132561-80132583 ATATAGGTAAAGAGTTTATTTGG - Intronic
992987183 5:82243496-82243518 ATATAAATAGAAAGCTGATGTGG + Intronic
993813726 5:92514770-92514792 ACATAAGTAGAGAGTTTATTTGG + Intergenic
994601597 5:101912323-101912345 ATCTAAGAATACAGCTAATTAGG - Intergenic
994709137 5:103244876-103244898 ATATTAGAAGGCTGCTTATTCGG - Intergenic
995348912 5:111152691-111152713 ATAAAAGGAGAAAGTTTATTGGG + Intergenic
995386023 5:111589902-111589924 ATCTAAGTAGAGAGCCTCTTTGG + Intergenic
996809348 5:127497577-127497599 ATATAAGTATTCAACTCATTTGG - Intergenic
996861881 5:128076633-128076655 ATATAAGTATACAGTTAGTTAGG + Intergenic
997377992 5:133411083-133411105 ATAGAAGTAGACAGGTTGTCAGG - Intronic
997917875 5:137947180-137947202 GAATAAGTAGAGAGATTATTTGG - Intronic
998178939 5:139922607-139922629 ATATAAGTTTTCAGCTCATTTGG - Intronic
1000106627 5:158065976-158065998 ATATAAGTAGAGAGTTTATTTGG + Intergenic
1000199591 5:158995053-158995075 ATATAAGTGGATGCCTTATTGGG - Intronic
1000806054 5:165794060-165794082 AGATAGATAGAAAGCTTATTTGG - Intergenic
1001060205 5:168481936-168481958 ATATAAGTAGAGAGTCTATTTGG - Intergenic
1001483017 5:172101621-172101643 ATATAACTTGCCTGCTTATTAGG - Intronic
1001537824 5:172510836-172510858 ATATAAGTAGAGAGTTTATTTGG + Intergenic
1004134069 6:12949744-12949766 ATAAAAGTAAACAGCTTCTGTGG + Intronic
1004149835 6:13105765-13105787 ATGTAAGTAGAGAGTTTATTTGG + Intronic
1005010279 6:21329162-21329184 ATATAAGCAGAGAGTTTATTTGG - Intergenic
1005355879 6:24983132-24983154 ACATAAGTAGAGAGTTTATTTGG - Intronic
1005401487 6:25438902-25438924 ATAGAAGTAGAAAGCTAATTTGG + Intronic
1005450859 6:25970766-25970788 AGATAAGTAGAGAGTTTATTTGG + Intronic
1005642068 6:27806087-27806109 ACATATGTAGAGAGCTTTTTAGG + Intergenic
1007770345 6:44186940-44186962 ACATAAGTAGAGAGTTTATTTGG + Intergenic
1007844696 6:44743430-44743452 ATATAAGTAGAAAGTTTATTTGG + Intergenic
1007847150 6:44768755-44768777 ATAAAAGTAGAAAGTTTATTTGG + Intergenic
1010639819 6:78310802-78310824 AGATAAGCAGAAAGCCTATTTGG + Intergenic
1011342463 6:86332143-86332165 ATTTGAGTCGACAGCTGATTTGG + Intergenic
1011436052 6:87338282-87338304 ATATAGGTAGGGAGTTTATTTGG + Intronic
1011456989 6:87561518-87561540 ATATAAGTAGAGAGTTTACTTGG - Intronic
1012779039 6:103533864-103533886 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1014596309 6:123344762-123344784 ACATAAGTTTTCAGCTTATTTGG + Intronic
1015080091 6:129213361-129213383 ATATAAATATTCAACTTATTTGG + Intronic
1016555547 6:145332488-145332510 ATATAAATAGAGAGTTGATTTGG - Intergenic
1017857232 6:158360416-158360438 ATATAAGAATACAGCCTCTTGGG - Intronic
1018785443 6:167104452-167104474 ATATAAGTAGACAGACGTTTTGG - Intergenic
1019226549 6:170515556-170515578 ATATAAGTAGAGAGTTTATCTGG + Intergenic
1020423477 7:8036671-8036693 ATATAAATGAACAGTTTATTAGG + Intronic
1020523233 7:9221920-9221942 ATAAATATAGACAGTTTATTAGG - Intergenic
1020624700 7:10563385-10563407 ATAAAAGTACAGAGTTTATTTGG + Intergenic
1020736771 7:11959748-11959770 ATGTAATTAGAGAGTTTATTGGG + Intergenic
1021291361 7:18849061-18849083 ATATAAGTAGCAAACTTAGTGGG + Intronic
1023706241 7:42944806-42944828 ATATTAGTAAAGAGATTATTTGG + Intronic
1024034922 7:45499498-45499520 ATATAAGTACAGAGTTTACTGGG + Intergenic
1024440149 7:49407625-49407647 ATATAACTAGAGAGTTTATTTGG - Intergenic
1024702205 7:51916348-51916370 AGAGAAGTTGACAGATTATTTGG + Intergenic
1025071810 7:55906202-55906224 ATCTAAGCGGAGAGCTTATTTGG - Intronic
1025774715 7:64550019-64550041 ATATAAGTAGACAGTTTATTTGG + Intronic
1025803241 7:64807434-64807456 ATATAAGTAGACAGTTCATTTGG - Intronic
1025859699 7:65315125-65315147 ATACAAGTAGAGAGTTTATTTGG - Intergenic
1025866145 7:65383202-65383224 ATGTAAGTAGACAGTTCACTTGG - Intronic
1026222063 7:68407467-68407489 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1026230683 7:68480870-68480892 AGATAAGTACCCAGCTCATTAGG - Intergenic
1026921627 7:74159883-74159905 ATATAAGGAGAGAGTTTATTTGG - Intergenic
1028841832 7:95436826-95436848 ATGTAAGTAGAGAGTTTATTTGG - Intergenic
1030157202 7:106467377-106467399 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1030436579 7:109529609-109529631 ATATAAGTAGAGAGTTTAGTTGG + Intergenic
1030444071 7:109626512-109626534 ACATAAGTAGAGAGTTTATTTGG - Intergenic
1030603458 7:111614622-111614644 ATATATGTAGAGAGTTTCTTTGG + Intergenic
1030663392 7:112247259-112247281 ATACAAGTAGAGAGCTCATTTGG - Intronic
1031097647 7:117440543-117440565 ATCTAAGTAAATTGCTTATTTGG - Intergenic
1031469276 7:122149779-122149801 ATATAAGTGAAGAGTTTATTTGG + Intergenic
1032367067 7:131309302-131309324 ATATAAGTAGAGAGTTTATTTGG + Intronic
1032368613 7:131324454-131324476 ATATAAGTTGGGAGTTTATTTGG + Intronic
1032465153 7:132139705-132139727 AAATAAGTAGGAAGGTTATTTGG + Intronic
1032810986 7:135417262-135417284 ATATCACTGGAGAGCTTATTAGG - Intronic
1033120243 7:138661839-138661861 ATATAAGTAGGGAGTTTATTTGG - Intronic
1033706793 7:143896114-143896136 ATATATGTAGTAAACTTATTTGG - Intronic
1034364872 7:150537251-150537273 AAAGAAGTAGGCAGCTTTTTCGG - Intergenic
1035181461 7:157092329-157092351 ATATAAGCAGAGAGTTTATTTGG + Intergenic
1035578244 8:722759-722781 AAATACGTGTACAGCTTATTTGG + Intronic
1035616770 8:1007729-1007751 ATATAAGGAAGCAGCTGATTTGG + Intergenic
1036466251 8:9000476-9000498 ATATAACTAGAGAGTTTATTTGG - Intergenic
1038066763 8:23971489-23971511 ATATAAATGGAGAGCTTATTTGG - Intergenic
1038438829 8:27557891-27557913 ATCTGAGTAGAGAGTTTATTTGG - Intergenic
1039282585 8:36002593-36002615 TTTTAAGTAGATAACTTATTTGG - Intergenic
1039502084 8:38026109-38026131 ATATAAGTAGGGAGTTTATTTGG + Intergenic
1039814358 8:41079912-41079934 ATGTAAGTAGAGGGTTTATTGGG - Intergenic
1041806191 8:61851810-61851832 ATATAAGTAGAGAGTTTATTTGG - Intergenic
1042198499 8:66255731-66255753 TTTCAAGTAGACAGCATATTTGG + Intergenic
1042384558 8:68158370-68158392 GTATAAGTAGAGAGTTTATTTGG + Intronic
1042385241 8:68166402-68166424 ATATAAGTAGAGAGTTTATTTGG + Intronic
1042537004 8:69869299-69869321 ATATTTATAGACAGTTTATTAGG - Intergenic
1042932786 8:74030061-74030083 GTGTAAGTAGAGAGTTTATTTGG + Intergenic
1043712260 8:83436496-83436518 AAATAAGTAGATAGCTCATTTGG + Intergenic
1044989788 8:97785521-97785543 ATGTAAGTAGAGAGTTTATTTGG + Intronic
1045099972 8:98834341-98834363 ATATAAGTAGAGAGTTTATTTGG - Intronic
1046064232 8:109177316-109177338 CTATAAGTAGATTGCTCATTGGG + Intergenic
1046706838 8:117463515-117463537 ATATATGTATATAGCTTATCAGG - Intergenic
1047006036 8:120621315-120621337 CTATAAGTGGACAGCTAACTAGG + Intronic
1047777019 8:128080221-128080243 ATGTAAGTTTTCAGCTTATTTGG + Intergenic
1050834470 9:10058494-10058516 ACATAAGTAGAGAGTTTATTTGG - Intronic
1052425266 9:28296061-28296083 AAGTAATTAGACAGCTAATTTGG + Intronic
1052673800 9:31593259-31593281 ATAAAAATAGAAAGTTTATTTGG - Intergenic
1053319004 9:37079095-37079117 ATATAAATAGAGAATTTATTTGG - Intergenic
1053323317 9:37119709-37119731 ATATAAGTGGAGAATTTATTTGG - Intergenic
1053700914 9:40689461-40689483 ATTTAACTAGAGAGTTTATTTGG - Intergenic
1054312207 9:63488859-63488881 ATTTAACTAGAGAGTTTATTTGG - Intergenic
1054410980 9:64812917-64812939 ATTTAACTAGAGAGTTTATTTGG - Intergenic
1055897031 9:81189222-81189244 ATATGAGTAGAAAAATTATTAGG - Intergenic
1055972651 9:81927175-81927197 TTATAAGTAGAGAGTTAATTTGG - Intergenic
1055974404 9:81942247-81942269 TTATAAGTAGAGAGTTAATTTGG - Intergenic
1056208456 9:84342329-84342351 ATGTAAGTATAGAGTTTATTTGG + Intergenic
1057591062 9:96373794-96373816 ATTAACGTAGAGAGCTTATTTGG - Intronic
1061966874 9:134019738-134019760 ATGTAAGTAGAGAGTTTATTTGG + Intergenic
1185919799 X:4078550-4078572 ATATAAGTAGAGAGTGTATGTGG - Intergenic
1185923994 X:4126200-4126222 ATATAAGTTGTCAACTTCTTTGG + Intergenic
1187037485 X:15556952-15556974 ATATAAGTAGACAGTTTATTTGG + Intergenic
1187526917 X:20062718-20062740 ATATATTTAGAAAGCATATTTGG - Intronic
1188059164 X:25579222-25579244 ATATAAGTAGAGAGTTTATTTGG + Intergenic
1188698235 X:33224238-33224260 ACATAAGTTTTCAGCTTATTTGG - Intronic
1189412954 X:40790185-40790207 ATATATGTATACAGATTATATGG + Intergenic
1189416430 X:40818229-40818251 ATACAAGTAGAGAGTCTATTTGG - Intergenic
1189480290 X:41387323-41387345 ATATACGTAGAGAGTTTATTTGG - Intergenic
1189633337 X:42977797-42977819 ATATAAGTAGAGAGTTTACTTGG + Intergenic
1189937645 X:46086729-46086751 ACATAAGTTTTCAGCTTATTTGG - Intergenic
1190031796 X:46980509-46980531 ATATAAGTAGATAGTTTATTTGG + Intronic
1190940753 X:55038338-55038360 ATATGAGTTGGCAGCTGATTAGG + Intergenic
1191178890 X:57538294-57538316 ATATAAATAGAGAGTTTATTTGG - Intergenic
1191637113 X:63391419-63391441 ATATAAGGAGAGAGTATATTTGG - Intergenic
1193018782 X:76767112-76767134 ATATAAGTAGAAAGTTTATTTGG - Intergenic
1193238778 X:79141681-79141703 ATATATATATGCAGCTTATTTGG - Intergenic
1194581300 X:95675375-95675397 ATATAAGTAGATACATTATTTGG + Intergenic
1195609490 X:106849445-106849467 ATATAAGTGGATGCCTTATTGGG + Intronic
1196824303 X:119728860-119728882 ATGTAAGTAGAGAGTTTATGTGG + Intergenic
1197344581 X:125317623-125317645 ATATAAGTAGTGAGTTTATTTGG - Intergenic
1199573633 X:149292005-149292027 TTATAAGGACACAGGTTATTAGG + Intergenic
1200694662 Y:6348327-6348349 ATTTAAGCAGACAAATTATTAGG + Intergenic
1201040615 Y:9826383-9826405 ATTTAAGCAGACAAATTATTAGG - Intergenic
1201785476 Y:17772403-17772425 AAAAGAGTAGAAAGCTTATTTGG + Intergenic
1201816077 Y:18133584-18133606 AAAAGAGTAGAAAGCTTATTTGG - Intergenic
1201922077 Y:19244729-19244751 ATATGAGTAGAAAGTTTATGTGG + Intergenic