ID: 1163904058

View in Genome Browser
Species Human (GRCh38)
Location 19:20135947-20135969
Sequence AGGTGTTAACTGCACATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163904056_1163904058 -1 Left 1163904056 19:20135925-20135947 CCTGAATGGCTGGAGTTGCAGCA No data
Right 1163904058 19:20135947-20135969 AGGTGTTAACTGCACATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163904058 Original CRISPR AGGTGTTAACTGCACATTTG TGG Intergenic
No off target data available for this crispr