ID: 1163908027

View in Genome Browser
Species Human (GRCh38)
Location 19:20164613-20164635
Sequence GATCAGAGCAGAACCCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163908023_1163908027 2 Left 1163908023 19:20164588-20164610 CCAGTAGAAAAAAAGAAATAACA No data
Right 1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG No data
1163908021_1163908027 8 Left 1163908021 19:20164582-20164604 CCAAACCCAGTAGAAAAAAAGAA No data
Right 1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG No data
1163908022_1163908027 3 Left 1163908022 19:20164587-20164609 CCCAGTAGAAAAAAAGAAATAAC No data
Right 1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG No data
1163908020_1163908027 9 Left 1163908020 19:20164581-20164603 CCCAAACCCAGTAGAAAAAAAGA No data
Right 1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG No data
1163908019_1163908027 14 Left 1163908019 19:20164576-20164598 CCAAACCCAAACCCAGTAGAAAA 0: 2
1: 56
2: 524
3: 628
4: 1230
Right 1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163908027 Original CRISPR GATCAGAGCAGAACCCTAGG GGG Intergenic
No off target data available for this crispr