ID: 1163908672

View in Genome Browser
Species Human (GRCh38)
Location 19:20169469-20169491
Sequence CAGCCTGCTCACCCCACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 5, 2: 17, 3: 54, 4: 424}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163908668_1163908672 -5 Left 1163908668 19:20169451-20169473 CCTCGCCTGCAGATGTCCCAGCC 0: 1
1: 6
2: 22
3: 28
4: 253
Right 1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG 0: 1
1: 5
2: 17
3: 54
4: 424
1163908669_1163908672 -10 Left 1163908669 19:20169456-20169478 CCTGCAGATGTCCCAGCCTGCTC 0: 8
1: 16
2: 16
3: 34
4: 269
Right 1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG 0: 1
1: 5
2: 17
3: 54
4: 424
1163908667_1163908672 18 Left 1163908667 19:20169428-20169450 CCTAGTTAGTTTTTTCTGGGGAG 0: 3
1: 6
2: 6
3: 28
4: 220
Right 1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG 0: 1
1: 5
2: 17
3: 54
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163908672 Original CRISPR CAGCCTGCTCACCCCACCCA TGG Intronic
900125800 1:1068527-1068549 CAGCCTCCTCCTCCCACCCTGGG + Intergenic
900203551 1:1421636-1421658 CAGCTGGCTAAGCCCACCCAGGG + Intronic
902216890 1:14939964-14939986 TAGCCTGATCATCCCACCCAGGG + Intronic
902620713 1:17649267-17649289 CTGCCTGATCACAACACCCAGGG + Intronic
902673004 1:17987979-17988001 CCGCCTGCTCTCCCTCCCCAGGG - Intergenic
903217553 1:21851770-21851792 CAGCCTGGTGGCCCCACTCACGG + Exonic
904049678 1:27631765-27631787 CAGCCCTCTCACCTCACCCTGGG - Intronic
904367576 1:30024557-30024579 CAGTCTTCACACCCCAACCATGG - Intergenic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904727934 1:32564045-32564067 CAGTCTGCTCACCGTGCCCATGG - Intronic
904853792 1:33479633-33479655 CAGCCTCCTCACCACTCTCAGGG - Exonic
905205640 1:36341421-36341443 GAGCCTGCTCACCCCACTCCAGG - Exonic
905404140 1:37721887-37721909 CAGCCTGCCCAGCTCAGCCAGGG - Intronic
905451422 1:38059293-38059315 GAGCCTGCTCTGCCCTCCCAAGG - Intergenic
905632570 1:39526859-39526881 CAGCCTGCTCCCCTTGCCCATGG + Intergenic
905731642 1:40302748-40302770 CATCATGCCCACCGCACCCAGGG + Exonic
905775123 1:40663458-40663480 CAGCCTGCTCCCCCCTCCCCAGG + Intronic
906477598 1:46180466-46180488 CCGCCTGCTGGCCCCACCCGTGG - Intronic
906705022 1:47888427-47888449 CAGGCTGTTCACCCCATACAAGG + Intronic
907053781 1:51346321-51346343 CTCCGTGCTCAGCCCACCCATGG - Intergenic
907429684 1:54405060-54405082 CAGCTAGCTCACCCCAAACAGGG + Intronic
912447955 1:109751826-109751848 CAGCCTTCCCTCCCCACACAAGG + Intronic
912509681 1:110180432-110180454 CAGCCAGCTCAGCTCAACCATGG - Intronic
912513582 1:110204376-110204398 CTGACTGCTCCCTCCACCCAGGG - Intergenic
912649506 1:111425334-111425356 CAGCCTGCTCCACCCTCCCAGGG + Intronic
912947804 1:114099104-114099126 CAGCCTGCTCATCTCAGTCATGG - Exonic
913250913 1:116911014-116911036 CAGCGCCCTCCCCCCACCCAAGG + Intronic
913325114 1:117621341-117621363 CTTCCTGTTCACCCCAACCAGGG + Intronic
913711434 1:121487891-121487913 CAGCCTGCACATCTCACCCATGG + Intergenic
914844125 1:151271631-151271653 GTCTCTGCTCACCCCACCCATGG - Intergenic
920051379 1:203166923-203166945 CAGCCTGCTAAACCCACCCCAGG - Exonic
924295514 1:242583235-242583257 CAGCCCGCTTACCCAACCAAGGG - Intergenic
1063158116 10:3398303-3398325 CAGCCTGCTCACCTGCACCATGG - Intergenic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1067059446 10:43070496-43070518 CACCCTGCACCCCACACCCAAGG + Intergenic
1070720960 10:78756848-78756870 CAGCCTCCTCATGCCACCCTCGG + Intergenic
1070770052 10:79077055-79077077 TGGCCTTCTCACCCCACCCTAGG + Intronic
1070801637 10:79247451-79247473 CTGCCTGCTTGGCCCACCCAGGG - Intronic
1070962314 10:80507586-80507608 CAGCTGGCTCCTCCCACCCAGGG - Intronic
1071274343 10:84039146-84039168 CAGCCTGCTGCCCCATCCCAGGG + Intergenic
1071315573 10:84392750-84392772 CAGCCTGCACACCCCAAAAAAGG - Intronic
1072211227 10:93248807-93248829 CCGCCTGCTCAGCCCATGCATGG - Intergenic
1073098888 10:100997024-100997046 CAGGCCGCGCCCCCCACCCAGGG - Intronic
1074044099 10:109820746-109820768 CATCCTGCCCCCCACACCCATGG - Intergenic
1074424073 10:113335761-113335783 CACCCTGGTCTCCCCAGCCAAGG - Intergenic
1075438180 10:122460470-122460492 CTGCCGGCTCACCCAACCCTGGG + Intergenic
1075546442 10:123358659-123358681 CAGCCTCCTCAAGCCCCCCAGGG - Intergenic
1075876009 10:125806337-125806359 CATCCTGATCTCACCACCCAAGG + Intronic
1076299743 10:129416002-129416024 CAGCCTGCTCAACATTCCCACGG + Intergenic
1076300418 10:129421501-129421523 CAGCCTGCCCCCTCCAGCCATGG + Intergenic
1076782306 10:132731081-132731103 CAGCGTGGAGACCCCACCCAGGG - Intronic
1076807283 10:132865319-132865341 CAGCCTCCTCTCCTCACCCTGGG - Intronic
1076905851 10:133360643-133360665 CACTCTGCCCACCCAACCCAAGG + Intergenic
1077167272 11:1149331-1149353 CAGCCTGGCCCCCTCACCCAGGG - Intergenic
1077315387 11:1917380-1917402 CAGCCTGCTCCCCACTCCCTGGG + Intergenic
1077480584 11:2812673-2812695 CTGCCTGCTCAAGCCCCCCATGG + Intronic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1078339878 11:10491110-10491132 CCGCCTCCTCACCCCAGCCCGGG + Intronic
1081760450 11:45573053-45573075 GAGCCTGCTCTCCCCACAAACGG - Intergenic
1081833821 11:46137039-46137061 CAGCCTGCTCGCCCCAGCCTCGG + Intergenic
1082001559 11:47395905-47395927 CAGCCTGACCACGCGACCCAGGG - Intergenic
1083238746 11:61370152-61370174 CAGCCTGCCTACCCTACCCGAGG - Intergenic
1083327434 11:61879891-61879913 GAGCCTGCCCTCCCCTCCCAGGG - Intronic
1083652378 11:64210988-64211010 CAGCCTCCCCACCTCACCCATGG - Intronic
1083927583 11:65817928-65817950 CAGCGTTTCCACCCCACCCACGG - Intergenic
1083955910 11:65982622-65982644 CAGCCCGCCCTTCCCACCCATGG - Intergenic
1084378965 11:68798542-68798564 CAGCCAGCTCCCCGCACACAGGG + Intronic
1084458594 11:69283797-69283819 CTGCCTGGGCCCCCCACCCAAGG - Intergenic
1084786082 11:71442368-71442390 CAGCCTGATCACCCCCCGCCTGG + Intronic
1084937603 11:72595415-72595437 CAAGCTGCTCCCCCCACCCCCGG - Intronic
1085018596 11:73191135-73191157 TTGCCAGCTCAGCCCACCCATGG - Intergenic
1085402091 11:76241402-76241424 CAGGCTCCTCACTCCTCCCAGGG + Intergenic
1085455222 11:76661650-76661672 CAGCCTGATCACCCCATGCCTGG + Intronic
1087394021 11:97573753-97573775 CCCCCCGCTCACCCCACCCCGGG - Intergenic
1088469278 11:110176485-110176507 CCTCCTGCTCCCCCCAGCCACGG + Intronic
1089174172 11:116536441-116536463 CACCCAGCTCATCTCACCCAAGG + Intergenic
1089383270 11:118051280-118051302 CAGCTTGCTCACCCACCCCTGGG + Intergenic
1089862074 11:121598441-121598463 CATCGTGCTAGCCCCACCCAGGG - Intronic
1090652419 11:128819256-128819278 CACCCTCCTCACCCCACCCCAGG + Intergenic
1090981289 11:131724814-131724836 CTGGCTGCTCTCCCCACCCCAGG - Intronic
1092100291 12:5877727-5877749 CATCCTGATCCCCCCACCCCAGG - Intronic
1096515362 12:52152505-52152527 CACCCTGCCCACCCCACGCCGGG + Intergenic
1096916769 12:55041389-55041411 CAGCCTTCACACCCCAATCAAGG - Intergenic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1097990002 12:65824569-65824591 CTGCCTGCTCCCGCCACCCTAGG + Exonic
1100984457 12:100190899-100190921 CACCCTGTCCACTCCACCCAAGG + Intergenic
1102001678 12:109561434-109561456 CAGCCAGCTCCCACCACTCACGG - Exonic
1102515129 12:113441280-113441302 CAGCCAGGCCTCCCCACCCACGG + Intergenic
1103558441 12:121779661-121779683 CTGGCTCCTCCCCCCACCCAGGG - Exonic
1103760204 12:123243962-123243984 CAGCCTGTCCACCTCACCCTCGG - Intronic
1104898588 12:132176025-132176047 GAGCCTGCTCACCTCGCCCTTGG + Intergenic
1105625231 13:22106330-22106352 CACCCTGCTCTCCCCTACCAGGG - Intergenic
1105715088 13:23055513-23055535 CAGCCTCTTCACCACACGCAGGG - Intergenic
1106132499 13:26951870-26951892 CAGCCTGCTAATTCCAACCAAGG + Intergenic
1110880582 13:80567413-80567435 CAGCTTGCTCTCCCCACCTTGGG - Intergenic
1111190747 13:84803439-84803461 CACCCTACCCACCCCACCCCCGG - Intergenic
1112880878 13:104104883-104104905 CACCCTTCTCTCCCCACCCCAGG - Intergenic
1112997809 13:105595976-105595998 CAGCCTGCTCAGCCCAACTGTGG + Intergenic
1113200911 13:107867055-107867077 CAGCCCGCTCTCCCCTGCCAGGG + Intergenic
1113271959 13:108684196-108684218 CAGCCTGCACACCCCTCCTGTGG - Intronic
1113574589 13:111385686-111385708 CATCCTGCAAACCCCAGCCAGGG + Intergenic
1115694428 14:35881354-35881376 CAGCCTGCTTACCCAGCCTATGG + Intronic
1116734436 14:48671134-48671156 ATGCCTGCTGACCCCTCCCAGGG + Intergenic
1119889694 14:78173597-78173619 CACACTGCTCCCCCCACCCTAGG + Intergenic
1121008208 14:90503852-90503874 CTGCCTGCTCACCTCCCCCAAGG - Intergenic
1121267746 14:92615364-92615386 CAGGATACTCACCTCACCCAGGG + Intronic
1122297513 14:100713714-100713736 GAGCCTGCTGACCCCTCCCAGGG + Intergenic
1122596391 14:102895908-102895930 CAGCCTGCTCACCCTCAACACGG - Intronic
1122672023 14:103379736-103379758 CAGGCTGCTCCCCCCACACCGGG - Intergenic
1122906570 14:104804313-104804335 CAGGCTGCCCACCCCAGCAAAGG - Exonic
1202902274 14_GL000194v1_random:50725-50747 CAGGCTCCTCTCCCCACCCTGGG - Intergenic
1123538324 15:21261583-21261605 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1123665567 15:22607766-22607788 CTGCCTGCCCACCCCACCTGAGG + Intergenic
1123695359 15:22875174-22875196 GAGCCTGCTGACCCCCACCAGGG - Intronic
1123752189 15:23364886-23364908 CTGCCTGCCCACCCCACCTGAGG - Intronic
1124069748 15:26380257-26380279 AAGCCTGCTCACCTGCCCCAGGG + Intergenic
1124104345 15:26723560-26723582 CAGGCTGCACTTCCCACCCATGG - Intronic
1124483121 15:30093251-30093273 CTGCCTGCCCACCCCACCTGAGG - Intronic
1124489570 15:30145319-30145341 CTGCCTGCCCACCCCACCTGAGG - Intronic
1124544662 15:30614313-30614335 CTGCCTGCCCACCCCACCTGAGG - Intronic
1124564621 15:30801742-30801764 CAGCCTGCCCACCCCGCCTGAGG - Intergenic
1124753957 15:32393008-32393030 CTGCCTGCCCACCCCACCTGAGG + Intronic
1124959033 15:34381667-34381689 CTGCCTGCTCACCCCGCCTGGGG + Intronic
1124975659 15:34527888-34527910 CTGCCTGCTCACCCCGCCTGGGG + Intronic
1125136598 15:36350938-36350960 CTGCCTGCCCACAACACCCATGG + Intergenic
1126350968 15:47744500-47744522 GAGCTTTCTCACCTCACCCAGGG - Intronic
1126677320 15:51171716-51171738 GAGCACCCTCACCCCACCCATGG + Intergenic
1126695326 15:51321089-51321111 CAGCCTGCTTACTTCATCCAGGG + Intronic
1127393850 15:58527984-58528006 CAGCCCACACTCCCCACCCACGG + Intronic
1129191592 15:73940958-73940980 CAGCTTGCTGCCCCCACCCCAGG - Intronic
1129242568 15:74260228-74260250 CAGCTTGCTCCCTCCACCCTCGG - Intronic
1129737682 15:77975128-77975150 CATGCTGACCACCCCACCCACGG - Intergenic
1129834665 15:78694616-78694638 CAGGCTGCTAAGCCCACCCCAGG - Intronic
1130468379 15:84204143-84204165 CTGCCTGCCCACCCCACCTGAGG + Intergenic
1130495887 15:84469399-84469421 CTGCCTGCCCACCCCACCTGAGG - Intergenic
1130573925 15:85073879-85073901 CTGCCTGCTCTCCCCAGTCAGGG + Intronic
1130590672 15:85208741-85208763 CTGCCTGCCCACCCCACCTGAGG + Intergenic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1131153767 15:90062541-90062563 CTGCCTCCCCACCCAACCCAAGG - Intronic
1133102621 16:3488385-3488407 CTCCCTGCACACACCACCCAAGG + Intergenic
1133232399 16:4372814-4372836 CACCCTGCACACTCCACCCCTGG - Intronic
1133809832 16:9152833-9152855 CCCTCTGCTCACCCCTCCCAGGG + Intergenic
1133928217 16:10211110-10211132 TATCCTGCTTGCCCCACCCACGG + Intergenic
1133992315 16:10717914-10717936 CACCCTCCTCTCCCCACCCCTGG + Intergenic
1136364563 16:29803720-29803742 GAGCCTCCTCACCCCTCCCTGGG - Intronic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1136867380 16:33768801-33768823 CAGTCTGCTCACCACGCTCAAGG + Intergenic
1137601212 16:49757656-49757678 CGGGCTCCTCACCCCACCCAAGG - Intronic
1138346525 16:56323777-56323799 CAGCCTGCTCCCCACACAGAAGG - Intronic
1139513881 16:67442225-67442247 CAGCCAGCTCGCTCCAACCAGGG + Intronic
1139966692 16:70749712-70749734 CAGCCGGCTCCCCACACCCCAGG - Intronic
1140055947 16:71525907-71525929 CTGCCTGCTCACTCCACCCTGGG - Intronic
1141553428 16:84821169-84821191 GAGCCTGCTTTCCCCATCCAGGG + Intronic
1141575723 16:84962418-84962440 GAGCCTGCTCGCCCCACTCCTGG + Intergenic
1141604946 16:85147328-85147350 CAGCCTGCTCACCTGCCCCATGG + Intergenic
1141646278 16:85369749-85369771 CAGCCAGCTCAGCCCAGCCAGGG - Intergenic
1141925269 16:87164315-87164337 GAGCCATCGCACCCCACCCAGGG - Intronic
1142242598 16:88954403-88954425 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242691 16:88954726-88954748 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242701 16:88954764-88954786 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242708 16:88954783-88954805 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242725 16:88954840-88954862 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242742 16:88954897-88954919 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242793 16:88955068-88955090 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242803 16:88955106-88955128 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242810 16:88955125-88955147 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242827 16:88955182-88955204 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242844 16:88955239-88955261 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242896 16:88955410-88955432 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242906 16:88955448-88955470 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242913 16:88955467-88955489 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242926 16:88955505-88955527 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242933 16:88955524-88955546 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242946 16:88955562-88955584 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242953 16:88955581-88955603 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242960 16:88955600-88955622 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242973 16:88955638-88955660 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242985 16:88955676-88955698 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242992 16:88955695-88955717 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243003 16:88955733-88955755 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243010 16:88955752-88955774 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243021 16:88955790-88955812 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243038 16:88955847-88955869 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243089 16:88955999-88956021 AAGGCTCCTGACCCCACCCAAGG + Intronic
1203104779 16_KI270728v1_random:1347402-1347424 CGGTCTGCTCACCACACTCAAGG - Intergenic
1203128735 16_KI270728v1_random:1614966-1614988 CGGTCTGCTCACCACACTCAAGG + Intergenic
1142684715 17:1571242-1571264 CACCCTGACCACCCCACCCCAGG + Intronic
1142693494 17:1620920-1620942 CAGCCTGCTCTGCTCACCCCCGG + Intronic
1143530316 17:7499170-7499192 CAGCCTGCTTCCCTCAGCCAGGG - Intronic
1143544418 17:7588060-7588082 GAACCTCCTCACCCCACCCTGGG - Exonic
1144440010 17:15272778-15272800 CAGCTTCCTCACGTCACCCAGGG + Intergenic
1144671922 17:17137771-17137793 CATCCAGCACACCCCACTCAAGG - Intronic
1145193358 17:20866995-20867017 CAGCCAGCGCTCCCCACCCAAGG + Intronic
1145298663 17:21614086-21614108 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1145723151 17:27090822-27090844 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1146792872 17:35762720-35762742 CCGCCTGCCCACCCCACCAGCGG + Intronic
1146821479 17:35986365-35986387 CATCCTGCTCACCACACCATGGG + Intronic
1146910123 17:36642923-36642945 CAGCCTCCTCACTCCACAGATGG + Intergenic
1147185839 17:38712750-38712772 CAGCATCCTCACCCCGCCCGTGG + Exonic
1147582257 17:41634127-41634149 CAGACTCTTCACCCGACCCATGG - Intergenic
1147594133 17:41705866-41705888 CAGCCCGCCTACCCCTCCCAGGG - Intergenic
1148080233 17:44963963-44963985 CAGGCAACTCACCACACCCAGGG + Intronic
1151553160 17:74833672-74833694 CTGCTTGCTCACCAGACCCAGGG + Intronic
1151571977 17:74931008-74931030 CCGCCTGCCCACCCAACCCCGGG + Exonic
1151896062 17:76981735-76981757 CAGCCTGCCCACCCCTGCCATGG + Intergenic
1151947991 17:77329880-77329902 TGTCCTGCTCACCCCTCCCAGGG - Intronic
1152259834 17:79260921-79260943 CTGCCGGCACACTCCACCCAGGG + Intronic
1152335637 17:79699062-79699084 CACCCTGCTGACCACACCCACGG + Intergenic
1152608155 17:81303269-81303291 CGGCCTGCTCAGCACACCCTGGG - Intergenic
1152698931 17:81809862-81809884 GAGCCTGCTGCCCCCTCCCACGG + Exonic
1153739836 18:8112389-8112411 CTGCCTGCTATCCCCACCCATGG - Intronic
1154103555 18:11499772-11499794 CACCCTACTCCCCCCACCCCAGG + Intergenic
1155358673 18:24979195-24979217 CAGCCTCCTCACCCAGCACATGG - Intergenic
1155555630 18:27016052-27016074 GACCCTGCTCATCCCAGCCATGG + Intronic
1157403306 18:47404027-47404049 CAGCTTGTTCTCTCCACCCATGG + Intergenic
1160596086 18:79975443-79975465 TAGGCTGCTCCCGCCACCCAAGG + Intronic
1160618138 18:80149364-80149386 CCGTCTGCTGACCACACCCAGGG - Intronic
1160736582 19:665374-665396 GAACCTGCTTAGCCCACCCAAGG - Intergenic
1160740498 19:683332-683354 CAGGCAGCCCACCCCACCCTGGG + Exonic
1160834649 19:1118986-1119008 GAGCCTGCGCACCCGACCCGGGG - Intronic
1161460060 19:4391215-4391237 GACACTGCTCACCCCACCCCTGG - Intronic
1162704826 19:12547650-12547672 CAGCCTTATCACTCCAACCAGGG - Intronic
1163516400 19:17766616-17766638 CATCAGGCTCACCCCACCCCGGG - Intronic
1163557238 19:17999711-17999733 AGGCCTCCTCGCCCCACCCAGGG - Exonic
1163713664 19:18861872-18861894 GCGCCTGCTCACCGCACCTAGGG - Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164005585 19:21145546-21145568 CAGTCTGCTCAACCCAGCCATGG + Intronic
1164027175 19:21363409-21363431 TAGCCTGCTCACTCCAGTCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164241302 19:23391758-23391780 CAGCTTGCTCACCTCAGCTATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1164413059 19:28021595-28021617 CTGGCTGCTCACCCCACAGAGGG + Intergenic
1164517562 19:28949039-28949061 CTGGCTGCTCACCCCACAGAGGG + Intergenic
1164960221 19:32421755-32421777 CTGCCTGCACACCCATCCCATGG - Intronic
1165200795 19:34142784-34142806 CAACCTGCTCAACCCCACCATGG + Intergenic
1166862698 19:45819122-45819144 CTGCCTGCTCAGCCACCCCAAGG + Intronic
1167152862 19:47719629-47719651 CAGCGTCCCCACCCCACCCCAGG - Intronic
1168332807 19:55579608-55579630 CAGCCTCCTCCACCCGCCCAGGG - Exonic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
926859279 2:17291758-17291780 GAGCCTGCCCAGGCCACCCATGG - Intergenic
927109798 2:19856408-19856430 CAGCCTCCTGACCTCACTCAGGG + Intergenic
927808850 2:26171002-26171024 CAGCCCGCTCACCCTGGCCAGGG - Intergenic
928100062 2:28431766-28431788 CAGCCTGCTTTCCCCACCAGCGG + Intergenic
932575707 2:72961282-72961304 CAGCCAGCCCACCCCACCTTCGG - Intronic
932707492 2:74038009-74038031 CACCCTGCTCTCCCCACCCAGGG - Intronic
932757918 2:74421704-74421726 CCGGCCGCTCACCCCGCCCAAGG + Intronic
934647175 2:96065737-96065759 GAGCCTGCTCATCCCACCCTGGG - Intergenic
934655388 2:96114640-96114662 CCCCCTGCCCACCCCTCCCAAGG + Exonic
934770860 2:96906971-96906993 CTGCCTGCTCCCCTCACCCCCGG - Intronic
936265376 2:111001172-111001194 CAGCCTTCTCAACACCCCCAAGG + Intronic
937594126 2:123652357-123652379 CAGCCTGCTGAGCCTAGCCAGGG - Intergenic
937908017 2:127061811-127061833 CAGGCTGCCCACCCCAACCCTGG + Intronic
937913962 2:127089917-127089939 CCCCCTGCTCCCCCCACCCAGGG + Intronic
938149692 2:128871457-128871479 CAGCCTGCTCCCCGAACCCCGGG - Intergenic
939471737 2:142630885-142630907 CAGCCTGCTCTTCATACCCATGG + Intergenic
946168803 2:217881388-217881410 CAGCCTGCCCCCCACCCCCAGGG - Intronic
946396847 2:219447694-219447716 CAGCCTCCTCCCCCCAGCCCTGG - Intronic
947214355 2:227736458-227736480 CAGCCAGCTCCCTCCTCCCAAGG - Intergenic
947621523 2:231594091-231594113 CAGCCACCTCACCCCACGCCAGG + Exonic
947812106 2:233011077-233011099 CAGCCCTCTCACCCCAACAACGG - Intronic
948087940 2:235266545-235266567 CAGCCAGCTCGCTCCTCCCAGGG + Intergenic
948903100 2:240965972-240965994 CAGCCTGGTTCCCCCACCAAAGG + Intronic
948934960 2:241157869-241157891 CCGCCTGCTCAGCCCAGCCTTGG + Intronic
949012716 2:241690489-241690511 CAGCCTGCTGACCTCAGCCCTGG + Intergenic
1168956959 20:1841156-1841178 CATCCTGCTCCCCCGACCCAAGG + Intergenic
1169091362 20:2863112-2863134 CAGCCCGCTCACTGCACCCTTGG - Intronic
1169193483 20:3671715-3671737 CAGCCTGCTCGCACCGCACATGG - Exonic
1169265041 20:4162263-4162285 CAGCCGCCTCACCCCGCCCTGGG - Intronic
1169863295 20:10173659-10173681 CAGCCTGTTGAGCCCACCCCTGG - Intergenic
1169933014 20:10854021-10854043 CAGCCTGGGCTCCCCATCCAGGG - Intergenic
1170365567 20:15594460-15594482 CAGCCCAGTAACCCCACCCAAGG - Intronic
1171117314 20:22536218-22536240 CAGCCACCTAACCCCACCAAAGG + Intergenic
1171394499 20:24823153-24823175 CACTTTCCTCACCCCACCCAGGG - Intergenic
1171561916 20:26134489-26134511 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1172178290 20:32985750-32985772 CAGCCTGGACACCGCCCCCAAGG - Exonic
1172972595 20:38884209-38884231 CAGCCTGCTCAGCCACGCCAGGG - Intronic
1174653447 20:52149590-52149612 CCGTATTCTCACCCCACCCAAGG - Intronic
1174696132 20:52560751-52560773 CAGCCTGGCCATTCCACCCAGGG - Intergenic
1176084939 20:63291552-63291574 GAGCCACCACACCCCACCCATGG - Intergenic
1176145013 20:63561689-63561711 CAGCCTGCTCACTGTACACACGG + Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176360951 21:5996021-5996043 CAGGCAGCTCACTCCACCCTGGG + Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176621642 21:9065492-9065514 CAGGCTCCTCTCCCCACCCTGGG - Intergenic
1176649393 21:9531145-9531167 CAGCCAGCCCTCCCCACCAAAGG - Intergenic
1178166707 21:29986000-29986022 CAGCATGCCCACTCCAGCCATGG + Intergenic
1178411130 21:32364622-32364644 AAGCGTGCACACCACACCCAAGG + Intronic
1178828484 21:36035197-36035219 CAGGAAGCTCTCCCCACCCAAGG + Exonic
1179397305 21:41053020-41053042 CAGCGTCCTCGCCCCATCCAGGG - Intergenic
1179470278 21:41605665-41605687 CAGCCTGCTCTGCTCACCCACGG - Intergenic
1179557962 21:42192691-42192713 CAGCCTGCCCTGCCCACCGAAGG + Intergenic
1179762567 21:43542529-43542551 CAGGCAGCTCACTCCACCCTGGG - Intronic
1180103985 21:45605319-45605341 CAGGCAGCTCACTCCACCCTGGG + Intergenic
1180194342 21:46183986-46184008 CAGGCTGGTCTCCCCACCCTAGG - Intronic
1180825627 22:18858945-18858967 CAGGCTGCTCACCCCAGGCCTGG - Intronic
1181306532 22:21920321-21920343 CTGCCTGCTCAGCTCACACAAGG + Exonic
1181407385 22:22694566-22694588 CATCCTGCCCACCACACACAGGG - Intergenic
1181415383 22:22755333-22755355 CATCCTGCCCACCACACACAGGG - Intronic
1181465884 22:23110410-23110432 CAGGAGGCCCACCCCACCCATGG + Intronic
1181642961 22:24214422-24214444 CTCCCTGCTCATCCCACCCTGGG - Intergenic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1182673127 22:32014616-32014638 CAGCCTCCGCCCCCCACCCCGGG - Intergenic
1183097316 22:35560803-35560825 CAGCATCATCTCCCCACCCAGGG - Intergenic
1183196616 22:36358076-36358098 GTGCCAGCTCACCCCACCCTGGG + Intronic
1183376353 22:37467684-37467706 CGTCCTCCCCACCCCACCCAGGG - Intergenic
1184194321 22:42916530-42916552 CAACCACCTCACCCCTCCCACGG + Intronic
1184399522 22:44265780-44265802 CAGCTTGCACACCCCAGCGATGG + Intronic
1184484336 22:44766920-44766942 CAGCCTCCTCACTCCACCTGCGG - Intronic
1184486821 22:44784902-44784924 CCCCCTACTCACCCCACCCTGGG + Intronic
1184583796 22:45434344-45434366 CAGCAGGCTCAGGCCACCCAGGG + Intergenic
1184722688 22:46324311-46324333 CAGTTTCCTCACCTCACCCAGGG + Intronic
1184806823 22:46800268-46800290 CTGCCTTCTCGCCTCACCCATGG - Intronic
1185128832 22:49026004-49026026 CACCCAGCTGACCCCATCCAGGG - Intergenic
1185244090 22:49764006-49764028 CAGCCTGGGCACCCCACCCAAGG + Intergenic
1203214860 22_KI270731v1_random:541-563 CAGGCTGCTCACCCCAGGCCTGG + Intergenic
950486483 3:13276873-13276895 CAGTGTGCTGCCCCCACCCAGGG - Intergenic
952933633 3:38378513-38378535 AGGCTTGATCACCCCACCCAGGG - Intronic
953624224 3:44557401-44557423 CAGCCTCCTCACCACTCTCAGGG - Exonic
953916335 3:46923295-46923317 CAGCCTGCACCCGCCACGCACGG + Intronic
954003421 3:47575387-47575409 CCACCTGATCACCCCACCCTGGG + Intronic
960311596 3:116123190-116123212 CAGGCAGCTCACTCCACCCTTGG - Intronic
962355040 3:134686430-134686452 CAGCCTGCTGACCCTAGCCCAGG - Intronic
965310059 3:167116321-167116343 CACCGCGCTCACCCCACCAAGGG - Intergenic
967043920 3:185719037-185719059 CTGCTTCCTCTCCCCACCCAAGG - Intronic
968280449 3:197472962-197472984 CACCATGCTCAGCCCATCCAGGG + Intergenic
968556513 4:1248670-1248692 CAGTCTGCTCTCCCCGCCCGCGG - Intronic
968891578 4:3372201-3372223 CTGTCTGCGCACCCCTCCCAGGG + Intronic
969183711 4:5460493-5460515 CAGCCTGCTATCCCCACACCTGG - Intronic
969277983 4:6149890-6149912 CTCCCAGCTCTCCCCACCCATGG + Intronic
969305895 4:6326164-6326186 CAGCCAGCCAACCCCTCCCAGGG - Intronic
969364382 4:6685719-6685741 CAGCCTGCACCCCCACCCCAGGG + Intergenic
969700501 4:8765147-8765169 CAGCCTGGCTACACCACCCAGGG - Intergenic
970313411 4:14806300-14806322 TAGTCTGCTCTCCACACCCATGG + Intergenic
970721522 4:18995029-18995051 CTGCCTGGCCACCCCAGCCATGG + Intergenic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
978540984 4:109816029-109816051 CAGCCCTGTCACCTCACCCACGG - Intronic
981078858 4:140618317-140618339 CAGCATCCTCACCCCCACCAAGG - Intergenic
982207026 4:153004566-153004588 CAGCCTCCTCCCAACACCCAGGG + Intergenic
982262363 4:153505877-153505899 CAGCCTCCTCACCACACCCTGGG - Intronic
985680722 5:1254288-1254310 GAGGCTGCTCGCCCCACACAGGG + Intronic
985731701 5:1553173-1553195 CTGTCTGCTCCCCCCACCCCTGG - Intergenic
986684061 5:10260205-10260227 CAGGCTGCCCACCCCACCTCTGG - Intronic
990140416 5:52696919-52696941 CAGTCTGTACACCTCACCCAAGG + Intergenic
992042505 5:72848893-72848915 CGGCCTGCCACCCCCACCCACGG - Intronic
992742328 5:79786112-79786134 CAACCTGCTCATCTCACCCTTGG - Intronic
995882850 5:116862181-116862203 CAGCCTTCACACCCCTCACATGG + Intergenic
997669811 5:135661463-135661485 CAGTTTGCTCACCTTACCCAAGG - Intergenic
998252498 5:140562341-140562363 CAGCCAACTCACCTCACCCCAGG + Exonic
999858663 5:155621791-155621813 CTGCCACCACACCCCACCCACGG + Intergenic
1001881800 5:175251041-175251063 CCACCTGGTCACCCCACCCCTGG + Intergenic
1002448008 5:179301949-179301971 CAGCCTGCACACCTCGCCCCTGG + Intronic
1002696137 5:181092438-181092460 GGCCCTGCTCACCCCACCCCTGG + Intergenic
1002874961 6:1202560-1202582 CTCCCTCCTCACCCCAGCCATGG + Intergenic
1003778739 6:9398882-9398904 CAGCCTCCCCACCCATCCCAGGG - Intergenic
1005288769 6:24357811-24357833 CAGCGGCCTCACCGCACCCAGGG + Exonic
1006228155 6:32558264-32558286 CAGCGCCCGCACCCCACCCAGGG - Intronic
1006794312 6:36722102-36722124 CAGACAGCTCACCCAGCCCAAGG - Exonic
1006915232 6:37589673-37589695 CAGTCTGATCACCCCAGCTAAGG + Intergenic
1007222932 6:40293402-40293424 CACCCTGCCCACCCCTCCCAAGG - Intergenic
1010283181 6:74043551-74043573 CAGCCTGCTCACCACAGCAGGGG + Intergenic
1010809971 6:80289967-80289989 CTGCCTGCTGGCCCCACCCAGGG + Intronic
1014674707 6:124349284-124349306 CAGCCTGCTCCCCCCTACAAAGG + Intronic
1015576521 6:134677533-134677555 CAGCTTGCTCCCCTCTCCCAGGG + Intergenic
1016369921 6:143362781-143362803 CTGCCTGCTTACCCTACCCACGG + Intergenic
1018074481 6:160199628-160199650 CAGCCCCCTCACCACACCAAAGG - Intronic
1019055561 6:169220617-169220639 CTTCCTCCTCACCCCACCAAAGG - Intronic
1019485965 7:1289286-1289308 CCGCCTGCTCTCCCGACTCAGGG - Intergenic
1019508321 7:1404700-1404722 CCCCCTCCTCACCACACCCAGGG - Intergenic
1019609894 7:1931059-1931081 CCAACTCCTCACCCCACCCACGG + Intronic
1019641634 7:2106548-2106570 CTGCCTTCTCCCCCCACCCCTGG - Intronic
1020012678 7:4815292-4815314 CAACCTGCTGGCCACACCCAGGG - Exonic
1020781196 7:12518662-12518684 AAGCCTGAGCACACCACCCAAGG - Intergenic
1021489940 7:21208841-21208863 CAACCTCCGCACCCCACCCTGGG + Intergenic
1022909604 7:34887861-34887883 CAGTCTCCCCACCCCACCCCTGG + Intergenic
1022942020 7:35250148-35250170 CAGGCTGGTCAGCTCACCCAGGG + Exonic
1023966649 7:44966337-44966359 CACCCTGCCCACCCCACACCTGG + Intronic
1024157938 7:46645416-46645438 CACCCTGCTCCTCCCAACCAGGG - Intergenic
1024255716 7:47538515-47538537 CAGACTGCTCCCCACATCCAAGG - Intronic
1024256783 7:47545562-47545584 CAGCCTGGTCTCCCCTCCCTTGG + Intronic
1024783250 7:52876146-52876168 CAGCCTGTTCACTCCAGACAAGG - Intergenic
1025042730 7:55662307-55662329 CAGCCTGCCCAACCCACCAGGGG + Intergenic
1025236300 7:57237020-57237042 CACCCAGCACACTCCACCCAGGG + Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025275950 7:57581204-57581226 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025778833 7:64581584-64581606 CAGCTTGCTCACACCAGCCGTGG + Intergenic
1025788968 7:64669993-64670015 TCCCCTGCTCACCCCAGCCATGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1027258020 7:76443643-76443665 CACCATGCCCACCCCACCCTGGG - Intergenic
1027280828 7:76608388-76608410 CACCATGCCCACCCCACCCTGGG + Intergenic
1028145716 7:87317990-87318012 CACCCTGCTCACCCCTGCCCAGG - Intergenic
1028609622 7:92695751-92695773 CAGCCTGCCTTCCCCACCCAGGG - Intronic
1028658718 7:93241347-93241369 CAGACTGGCCACTCCACCCAAGG - Intronic
1029315596 7:99710337-99710359 CAACCTGCACAGCGCACCCAGGG + Intronic
1029321326 7:99763129-99763151 CAGCCTGCACAGCACACCCAGGG + Intronic
1029331530 7:99860371-99860393 CAGCCTGCCCAGCGCACCCAGGG - Intronic
1029421943 7:100476479-100476501 CTGGCTGCTCACCCCCACCATGG + Intronic
1029735256 7:102462096-102462118 CAGCCTGCTCAGCCGACACACGG - Intronic
1030037072 7:105416986-105417008 CAGTTTGCTCACCCCATCCGAGG + Intergenic
1030091338 7:105861598-105861620 CAGAGTGCTCATCCCACCCCCGG - Intronic
1031973966 7:128082385-128082407 CAGCCTCCTCAGCCCACCCCAGG + Intronic
1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG + Intergenic
1033328419 7:140398283-140398305 CTGCCTGGGCGCCCCACCCAAGG + Intronic
1034243643 7:149627922-149627944 CAGGCTGCTGCCCCAACCCAGGG + Intergenic
1034959945 7:155358868-155358890 CAGCCTGCACGCCCGCCCCACGG + Intronic
1035581929 8:745982-746004 CGGCCTGCTCAGGCCAGCCAAGG + Intergenic
1037395332 8:18435614-18435636 CAGCCTGCTTACCTTACCCCTGG + Intergenic
1037594806 8:20346008-20346030 CAGCCAGCACAGCTCACCCATGG - Intergenic
1037773903 8:21820085-21820107 CAGCCTGCTCCACTCACTCAGGG + Intergenic
1039822029 8:41142894-41142916 CACCCTGCTCACCCAGCCCACGG + Intergenic
1039845931 8:41325390-41325412 CAGCCAGAGCATCCCACCCAGGG + Intergenic
1039918742 8:41878267-41878289 CAGCCTGGTGCCCCCACCCTGGG + Intronic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1040899739 8:52406018-52406040 CAGCCTGCAAATCCCACTCATGG - Intronic
1042798951 8:72696610-72696632 CAGGCTGCTCTCTCCATCCACGG - Intronic
1047083643 8:121492515-121492537 CAGCCTGCTCATCCTACATATGG + Intergenic
1047174370 8:122526674-122526696 CCGCATGCACACCCCACCCATGG + Intergenic
1047498864 8:125427468-125427490 CACCCAGCTCCGCCCACCCAGGG - Intergenic
1047752205 8:127890320-127890342 CAGCCTCCTCTCCCCTCTCAGGG + Intergenic
1049286839 8:141780498-141780520 CATCCTGCACAGTCCACCCAGGG - Intergenic
1049334339 8:142074812-142074834 TAGCCTGCACTGCCCACCCACGG + Intergenic
1049337002 8:142092000-142092022 CAGCCTTCCCAGCCTACCCAAGG + Intergenic
1049384160 8:142332675-142332697 CAGCCTGCAGACCCTTCCCATGG - Intronic
1049408666 8:142462815-142462837 CAGTCTCCTCACCACCCCCAAGG - Intronic
1049623309 8:143609016-143609038 CTGTCTCCTCCCCCCACCCAGGG + Intronic
1050195098 9:3074663-3074685 CACCCTTCTCACCACACCTATGG + Intergenic
1051364588 9:16312473-16312495 CAGCCTGCTTGCCCCACCCTGGG + Intergenic
1053807438 9:41817440-41817462 CAGTCTGCTCACCCCTCCTGGGG - Intergenic
1054623154 9:67369987-67370009 CAGTCTGCTCACCCCTCCTGGGG + Intergenic
1055744331 9:79426592-79426614 CAGCCTGGTGAGCCCACCCCTGG - Intergenic
1056587441 9:87937935-87937957 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1056609435 9:88115007-88115029 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1056724930 9:89106484-89106506 CAGCTTTCTCAGCCCACACAGGG + Intronic
1056931069 9:90877837-90877859 CAGGCTGCTCGGCCCATCCAGGG - Intronic
1057570253 9:96198845-96198867 CCGGCTGCTCACCCTGCCCAAGG + Intergenic
1058880975 9:109285767-109285789 CAGCCTGGACACCCCACCCGGGG + Intronic
1059435287 9:114272257-114272279 CAGCCTTCTCACTCCACTCTGGG + Intronic
1059923170 9:119180018-119180040 CAGCCTGGGCTCCCCAGCCAGGG - Intronic
1060945270 9:127566757-127566779 CACCCTCCTCACCCCACCCAAGG - Intronic
1061062411 9:128257335-128257357 CTGCCTGCCCACCCCTCCCGAGG + Intronic
1061249812 9:129420204-129420226 CATTCTGCTCCCCCCATCCAAGG - Intergenic
1062265704 9:135685652-135685674 CCCCCGGCTCACCCCACCCCCGG - Intergenic
1062265712 9:135685668-135685690 CCCCCGGCTCACCCCACCCCCGG - Intergenic
1062581538 9:137231144-137231166 GGGCCTGGTCACCCCACCCCTGG - Intronic
1203744826 Un_GL000218v1:35902-35924 CAGGCTCCTCTCCCCACCCTGGG - Intergenic
1203565278 Un_KI270744v1:83582-83604 CAGGCTCCTCTCCCCACCCTGGG + Intergenic
1203627134 Un_KI270750v1:34693-34715 CAGCCAGCCCTCCCCACCAAAGG - Intergenic
1186457998 X:9725756-9725778 GACCCTGCTCTCCCAACCCATGG - Exonic
1189023782 X:37370547-37370569 CAGCCTGCTCCCAGCCCCCAAGG - Intronic
1190252437 X:48737389-48737411 CTTCCTCCTCACCCCACCCCCGG + Intergenic
1191255933 X:58279646-58279668 CAGCCCCCGCACCCCACCCAGGG - Intergenic
1191842767 X:65524867-65524889 CAGCCTTCACACCCCAACCCAGG + Intronic
1191853169 X:65601340-65601362 TCCCCTCCTCACCCCACCCAAGG - Intronic
1192456941 X:71283868-71283890 CTGCCTTCTCAGCCCACCCGCGG + Intronic
1192503272 X:71666701-71666723 CAGCCTGCTCGCCACCCCCCAGG + Intergenic
1192756382 X:74050198-74050220 CAGGCTGCACACCACAGCCACGG - Intergenic
1192784249 X:74321961-74321983 TAACCTGACCACCCCACCCAGGG - Intergenic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1196379044 X:115069130-115069152 CTGCCTGCGCAACCCTCCCAGGG + Intergenic
1198381796 X:136090988-136091010 AAGCCTGCTCTCCCTTCCCAAGG - Intergenic
1200072085 X:153534187-153534209 CAGCCTCCCCTCCCCACCCCAGG - Intronic
1200150487 X:153949020-153949042 CAGCCAGCTCCGCCCTCCCAAGG - Exonic
1200151028 X:153951577-153951599 CACCCGACTCACCACACCCAGGG + Exonic
1200403719 Y:2787019-2787041 CAGCCAGCTCACCGCAGCAACGG - Exonic
1200686564 Y:6264494-6264516 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200992112 Y:9355743-9355765 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200994764 Y:9376021-9376043 CAGCCGCCTCACACCACCCCCGG - Intronic
1200997428 Y:9396367-9396389 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200999940 Y:9464903-9464925 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201002601 Y:9485213-9485235 CAGCCGCCTCACACCACCCCCGG - Intronic
1201005256 Y:9505497-9505519 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201007917 Y:9525826-9525848 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201010534 Y:9546017-9546039 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201158164 Y:11150945-11150967 CAGGCTCCTCTCCCCACCCTGGG - Intergenic
1202367302 Y:24174164-24174186 CTGCCTGCCCACCCCACCTGAGG - Intergenic
1202503479 Y:25495959-25495981 CTGCCTGCCCACCCCACCTGAGG + Intergenic