ID: 1163908679

View in Genome Browser
Species Human (GRCh38)
Location 19:20169486-20169508
Sequence CAGGATAAAGGCTCCTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 3, 2: 12, 3: 28, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163908679_1163908683 -2 Left 1163908679 19:20169486-20169508 CCATGGAAGGAGCCTTTATCCTG 0: 1
1: 3
2: 12
3: 28
4: 208
Right 1163908683 19:20169507-20169529 TGAGAGAAGCTACGGAGCCCTGG 0: 1
1: 18
2: 12
3: 25
4: 285
1163908679_1163908684 6 Left 1163908679 19:20169486-20169508 CCATGGAAGGAGCCTTTATCCTG 0: 1
1: 3
2: 12
3: 28
4: 208
Right 1163908684 19:20169515-20169537 GCTACGGAGCCCTGGAAAGCTGG 0: 1
1: 18
2: 16
3: 28
4: 176
1163908679_1163908687 17 Left 1163908679 19:20169486-20169508 CCATGGAAGGAGCCTTTATCCTG 0: 1
1: 3
2: 12
3: 28
4: 208
Right 1163908687 19:20169526-20169548 CTGGAAAGCTGGAGCCCCACAGG 0: 2
1: 5
2: 12
3: 50
4: 244
1163908679_1163908681 -10 Left 1163908679 19:20169486-20169508 CCATGGAAGGAGCCTTTATCCTG 0: 1
1: 3
2: 12
3: 28
4: 208
Right 1163908681 19:20169499-20169521 CTTTATCCTGAGAGAAGCTACGG 0: 1
1: 0
2: 1
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163908679 Original CRISPR CAGGATAAAGGCTCCTTCCA TGG (reversed) Intronic
900205470 1:1430360-1430382 CAGGGTCAAGGCTCATTCCGTGG + Intergenic
901767344 1:11511582-11511604 CAGGGTACAGCCTCCTTCCTAGG + Intronic
903402868 1:23069905-23069927 CACTATAAAGGCCCCCTCCAGGG - Intronic
908187548 1:61667154-61667176 CAGAATAAAGGCCCCCTCCAGGG + Intergenic
909070104 1:70983895-70983917 CTGGTTAAAGTCTACTTCCAGGG - Intronic
909695742 1:78466010-78466032 CAGAATAGAGACTCCATCCATGG - Intronic
909873726 1:80778270-80778292 CAGGATAGAGGCTGAATCCACGG + Intergenic
910448285 1:87320729-87320751 CACGACAAAAGCTCCATCCATGG - Intergenic
912560113 1:110545066-110545088 AAGGAGAAAGGATCTTTCCAGGG - Intergenic
913441920 1:118907272-118907294 CAGGATGAAGGCTCCGTCAGAGG + Intronic
913539219 1:119802969-119802991 CAGGATCAAGTGTCCTTCCTGGG - Intronic
915299757 1:154945256-154945278 CAGGATAAAGGCTCCAGTCGGGG + Intronic
915327535 1:155088394-155088416 CAGGATAATGGCCGCTTCCCAGG + Intergenic
917647270 1:177041476-177041498 CATGAGACAGGCTCCCTCCATGG + Intronic
918127599 1:181598020-181598042 GAGGTTAAAGGATCCTCCCAAGG + Intronic
919757446 1:201074799-201074821 CAGGATTCAGGCTCCTTCCTGGG - Intronic
920174988 1:204095087-204095109 CAGGAGTAAACCTCCTTCCACGG + Intronic
920674704 1:208030892-208030914 GAGGATAAAGTCTCATACCAGGG + Intronic
922176493 1:223201882-223201904 CAGGAAAAGGACTCCTACCATGG - Intergenic
923502671 1:234578955-234578977 CAGCACAAAGAGTCCTTCCAGGG + Intergenic
1063853312 10:10218089-10218111 CAGGAACATGGCTCCTACCAGGG + Intergenic
1064260632 10:13783121-13783143 AAGGAAAAAGGCACCATCCATGG + Intronic
1064363927 10:14690271-14690293 GAAGATCAAGGCTCCTTTCAAGG + Intronic
1064515764 10:16146368-16146390 CAGAATAAAGCCTTCTTCCCTGG - Intergenic
1065632549 10:27695258-27695280 AAGGAGAAACGCTCCTTCCCAGG + Intronic
1065650879 10:27889899-27889921 ATGGATAAATGCTCTTTCCAGGG + Intronic
1065967460 10:30781378-30781400 CAGGAAAAATGCTCCTTCCCAGG + Intergenic
1066710427 10:38227585-38227607 CAATATAAAGCCTCCTTCAATGG - Intergenic
1066975386 10:42363579-42363601 CAGTAGAAAGGATTCTTCCATGG + Intergenic
1066979580 10:42399863-42399885 CAGTATAAAGGCTCCTTCAATGG + Intergenic
1070641963 10:78176777-78176799 CAGGATAAAGGCTGAATACAGGG + Intergenic
1072767644 10:98108599-98108621 CAGCATGAAGCCTCCATCCATGG - Intergenic
1073620453 10:105041937-105041959 CTGGCTCAAGTCTCCTTCCATGG - Intronic
1075177588 10:120180334-120180356 CAGGAGAAAGGTCCCTCCCACGG + Intergenic
1076572101 10:131439625-131439647 CTGGAAAAAGGCTCTTCCCATGG + Intergenic
1076800345 10:132819801-132819823 CAGGATAAAAGCTCCTTGACTGG + Intronic
1077503054 11:2917863-2917885 CAGGGTAAAGCTTCCTTCCTTGG - Intronic
1077574994 11:3376181-3376203 CTGTAGAAAGGCTCCTTCCATGG + Intronic
1082761133 11:57127957-57127979 GAGGATGAAATCTCCTTCCATGG - Intergenic
1082774878 11:57237180-57237202 CAGGAGACAGGCTTCCTCCAGGG - Exonic
1082958082 11:58893162-58893184 CAGGATACAGGCTGCTGGCATGG - Intronic
1084633650 11:70374825-70374847 CAGGAGAAAGATTCCTACCATGG - Intronic
1084898844 11:72294770-72294792 CAGGACCAGGGCTCTTTCCATGG - Intronic
1086916020 11:92531161-92531183 TAGGACAAGGGCTCCTTTCATGG - Intronic
1088334676 11:108690545-108690567 CAGGATAATGGCTCCTCAAATGG + Intronic
1089494323 11:118900742-118900764 CAGGCTCAAGTCTCCTTCCATGG - Exonic
1089533238 11:119145426-119145448 CAGGACAGAGCCTCCATCCAGGG - Intergenic
1091835175 12:3580757-3580779 CAGGCTCCAGGCTCTTTCCAAGG - Intronic
1092757035 12:11773588-11773610 ATGGATAAAGTCTCCTTCAAAGG - Intronic
1093774112 12:23052628-23052650 CAGGAAAAAGGATCCGTCTAGGG - Intergenic
1096382850 12:51173341-51173363 TAGAAGAAGGGCTCCTTCCATGG - Intergenic
1097021329 12:56022637-56022659 CAGGATCAAGTCTACTTTCATGG - Intronic
1098571974 12:71998002-71998024 AAGGATCAAGTGTCCTTCCAAGG + Intronic
1099838043 12:87932783-87932805 AAGGAAACACGCTCCTTCCATGG + Intergenic
1100180807 12:92084309-92084331 CAGGAGAAAGACTCTTACCAAGG + Intronic
1101700464 12:107169059-107169081 CAGTATACAGGCTGCTTTCATGG + Intergenic
1103083165 12:118041503-118041525 CAGGAGAAAGGTCCCTCCCATGG + Intronic
1104151841 12:126091422-126091444 CAGGAAAAATGCTGCTTCCAAGG - Intergenic
1104976100 12:132552649-132552671 CAGGCTGGAGGCCCCTTCCATGG + Intronic
1112485412 13:99815145-99815167 CAGGACAAAGGATCCCTCCGTGG + Intronic
1118394385 14:65323327-65323349 CTTTATAAAGGCTCCTTCCATGG - Intergenic
1121850717 14:97219188-97219210 CAGGAGAAAGGGACCTGCCATGG - Intergenic
1121957940 14:98231128-98231150 CAGGTTTATGGCTCCTTCCCTGG + Intergenic
1123063818 14:105606339-105606361 CAGAATCATGGGTCCTTCCAGGG - Intergenic
1123506091 15:20942048-20942070 GAGGAAGAAGGCTCCTTCCTTGG - Intergenic
1123563321 15:21515755-21515777 GAGGAAGAAGGCTCCTTCCTTGG - Intergenic
1123599572 15:21953038-21953060 GAGGAAGAAGGCTCCTTCCTTGG - Intergenic
1127971634 15:63966641-63966663 TAGTCTAAATGCTCCTTCCATGG + Intronic
1128061155 15:64736780-64736802 GAGGATAAAGCCTCCTGCAAAGG - Intergenic
1129717242 15:77859622-77859644 CAGGCTAAAGGCCACCTCCAGGG + Intergenic
1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1130188143 15:81705314-81705336 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1132026616 15:98409094-98409116 AAGGTTAATGGCCCCTTCCAAGG - Intergenic
1202971675 15_KI270727v1_random:242889-242911 GAGGAAGAAGGCTCCTTCCTTGG - Intergenic
1132492401 16:239679-239701 CAGGAGAAAGGCTTACTCCATGG + Intronic
1135351329 16:21731685-21731707 CAGGAAGGAGTCTCCTTCCATGG + Intronic
1135449812 16:22547811-22547833 CAGGAAGGAGTCTCCTTCCATGG + Intergenic
1135640748 16:24117906-24117928 CAGGCTAAGGGCTGCTCCCAGGG + Intronic
1135983192 16:27164576-27164598 CAGGATCAATTCTCCTTCCCTGG + Intergenic
1136003145 16:27311511-27311533 CAGGACAAAGGCAGCTTGCAGGG + Intergenic
1139749063 16:69097697-69097719 CAGGGAAAAGCCTCCTTCTAGGG + Intergenic
1139767061 16:69239433-69239455 CAGGATACAGGACCATTCCATGG + Intronic
1144875120 17:18393569-18393591 CAGGAAAAGGCCTCCCTCCAAGG - Intergenic
1145157104 17:20550852-20550874 CAGGAAAAGGCCTCCCTCCAAGG + Intergenic
1147126975 17:38377705-38377727 CAGGCTGAAGGTTCCTGCCATGG - Exonic
1147215727 17:38897939-38897961 TAGGAAAAAGGTTCTTTCCAGGG - Intronic
1147226927 17:38986379-38986401 CAGGATAATGGTTACCTCCAAGG - Intergenic
1148019443 17:44543482-44543504 CAGCATTCAGGCTCCTCCCAAGG + Intergenic
1150273399 17:63881131-63881153 CAGGATATAGGCTTCTTCCTAGG + Exonic
1151843706 17:76636365-76636387 CAGAGTAAAGGATCTTTCCAGGG - Intronic
1153398739 18:4657052-4657074 AAGCATAAAAACTCCTTCCAAGG + Intergenic
1154172514 18:12061680-12061702 GAGGAGGAAGGCTCCTTCCTTGG - Intergenic
1158110865 18:53940215-53940237 AAGGATCTAGGCTCCTTCTATGG - Intergenic
1160125430 18:76167464-76167486 CAGGAAGAAGGCTACGTCCAGGG + Intergenic
1160861757 19:1240161-1240183 CAGGCTCAAGGCCCTTTCCAGGG + Intergenic
1161049231 19:2153581-2153603 CAGGAGAATGGCTCCGCCCAGGG + Intronic
1163870534 19:19817580-19817602 CAGAATAAAGGCTTCTTCTATGG + Intronic
1163879203 19:19902634-19902656 CAGAATAACGCCTCCTTCCATGG - Intronic
1163884530 19:19954145-19954167 CAGAATAAAGGATCCTTCCATGG + Intergenic
1163905106 19:20145332-20145354 CAGGATAAAGGCTTCTTCTATGG + Intergenic
1163908679 19:20169486-20169508 CAGGATAAAGGCTCCTTCCATGG - Intronic
1163915043 19:20233816-20233838 GAGGATGAAGGCTCCTTCCATGG + Intergenic
1163948546 19:20563240-20563262 CAGGATAAAGCCTCCTTCTATGG + Intronic
1163957724 19:20659886-20659908 CAGAATGAAGGCTCCTTCCGTGG + Intronic
1163958984 19:20669515-20669537 CAGAACAACGGCTCCTTCAATGG - Intronic
1163969562 19:20779035-20779057 CAGGATAAAGGCTCCTTCTATGG - Intronic
1163999666 19:21085711-21085733 CAGCAGAAAGGCTTCTTCCATGG - Intronic
1164005588 19:21145563-21145585 CAGCAGAAAGGCTTCTTCCATGG - Intronic
1164030647 19:21400661-21400683 CAGCAGAAAGGCTTCTTCCATGG - Intronic
1164042924 19:21509616-21509638 CAGGATAAAGCCTCCTTCCATGG - Intronic
1164070535 19:21764076-21764098 CAGCAGATAGGCTTCTTCCATGG + Intronic
1164095526 19:22006579-22006601 CACTATAGAGGCTTCTTCCATGG + Intronic
1164101379 19:22057419-22057441 CAGGATAAAGGCTTCTTCCATGG - Intronic
1164114995 19:22211264-22211286 CACTATAGAGGCTTCTTCCATGG + Intergenic
1164123622 19:22290211-22290233 CAGGATAAAGGCGTCTTCCATGG - Intronic
1164136264 19:22419368-22419390 CACTATAAAGGTTTCTTCCATGG + Intronic
1164183024 19:22836201-22836223 CGGAATAAAAGCTTCTTCCATGG - Intergenic
1164198801 19:22999429-22999451 CACTATAGAGGCTTCTTCCATGG + Intronic
1164225931 19:23245961-23245983 CAGATAAAAGGCTTCTTCCATGG + Intronic
1164243545 19:23410817-23410839 AAGTATAAAGGCTCTGTCCATGG + Intergenic
1164272141 19:23682566-23682588 CAGGATAAAGCCTTCTTCCATGG + Intronic
1168562234 19:57394131-57394153 CAGCCTGAAGGATCCTTCCATGG + Intronic
924999940 2:396911-396933 CAGTATAAAGGCATTTTCCAAGG + Intergenic
925917443 2:8616897-8616919 GAGAAGAAAAGCTCCTTCCAGGG + Intergenic
926421228 2:12701770-12701792 CAGGAAGATGGCTCCTTCCGGGG + Intergenic
926931622 2:18046886-18046908 CAGGATAAGGGCCCAGTCCAGGG - Intronic
927595582 2:24394045-24394067 CAGGTTAAAGCCTTCTTCCTTGG + Intergenic
927828423 2:26326761-26326783 AAAGAAAAAGGCTACTTCCATGG - Intronic
929142165 2:38676171-38676193 CAGGAAAGAGGCCCCTTCCATGG + Intronic
933175928 2:79173072-79173094 AAGGATAAAGACTACATCCAAGG + Intergenic
934738020 2:96699783-96699805 CAGGATGCAGGCTTCTCCCAAGG - Intergenic
934765950 2:96880134-96880156 AAGGAGAAAGGGCCCTTCCAGGG + Intronic
935059606 2:99595987-99596009 GAGGATGAAGGCCCCTTCCCTGG + Intronic
935517417 2:104058275-104058297 CAGGAAAATGGCTCATTCAAAGG + Intergenic
940080910 2:149800277-149800299 CAGGACAGAGGCTGCCTCCAAGG + Intergenic
941476343 2:165955498-165955520 CGGAATAAAGGCTCCTTGAAGGG - Intergenic
942648617 2:178143505-178143527 TAAGATAATGTCTCCTTCCAGGG + Intergenic
943572059 2:189585269-189585291 CAGTATGAAGGCCCCTCCCAAGG + Intergenic
944292935 2:198028468-198028490 CAGGATAAATCCTCCTATCAGGG - Intronic
1169542530 20:6615800-6615822 CAGGATAAATTCTTCTACCATGG - Intergenic
1170053279 20:12170879-12170901 CTGGAAATAGGCTCCTTCAAAGG - Intergenic
1170840752 20:19922976-19922998 CAGGATGAAGGCTGCGTCCAAGG - Intronic
1171110817 20:22480637-22480659 CAGGATGAAGCCACCCTCCAGGG - Intergenic
1171404387 20:24900129-24900151 CAGGCTAAAGGGCACTTCCATGG + Intergenic
1172212594 20:33211481-33211503 CCTGATAAAGGCTCCCTCCTGGG + Intergenic
1173789290 20:45817359-45817381 CAGGAAAAAAGCCCCTTCCCTGG + Intergenic
1174040112 20:47693735-47693757 CAGGATACTGGCTACCTCCAGGG + Intronic
1176334675 21:5584954-5584976 AGTGACAAAGGCTCCTTCCATGG + Intergenic
1176393082 21:6235994-6236016 AGTGACAAAGGCTCCTTCCATGG - Intergenic
1176468337 21:7080180-7080202 AGTGACAAAGGCTCCTTCCATGG + Intronic
1176491898 21:7461958-7461980 AGTGACAAAGGCTCCTTCCATGG + Intergenic
1176508744 21:7676425-7676447 AGTGACAAAGGCTCCTTCCATGG - Intergenic
1179146160 21:38769703-38769725 GAGCACAAAGGCTCCTCCCAGGG + Intergenic
1179330328 21:40394697-40394719 CAAGATCAAGGCTCCCTCTAGGG - Intronic
1182075772 22:27494549-27494571 CAGCTCAAGGGCTCCTTCCAGGG + Intergenic
1182303677 22:29353282-29353304 CACGACAAAGGCTCCTTGCTTGG - Intronic
1184982242 22:48102831-48102853 CAGGGTGGGGGCTCCTTCCAGGG - Intergenic
1185132360 22:49046466-49046488 CAGGTCAAAGGCCCCTTCCAGGG - Intergenic
1185415550 22:50707507-50707529 CAGGAAAAGGGTTCCTTCTATGG - Intergenic
951076197 3:18395771-18395793 CAGGATGAATGCTTCTTCCTTGG + Intronic
951269094 3:20603234-20603256 CAGGATAAGGGCTGCATCCATGG - Intergenic
951435095 3:22653316-22653338 CATAATAAAGTCTCCTACCAAGG - Intergenic
954544169 3:51418659-51418681 CAGGGTAAGGGTTCCTTCCTAGG - Exonic
954975597 3:54691235-54691257 CAAGAGAAAGGCTATTTCCATGG - Intronic
957146469 3:76430641-76430663 CAGAACACAGGCTCCATCCAGGG - Intronic
959413925 3:106061240-106061262 GAGTATAAATGCTCCCTCCATGG - Intergenic
960148074 3:114224641-114224663 CAGGCTAAAGGATCATTCCCAGG - Intergenic
965123829 3:164598020-164598042 AAAGATAATGTCTCCTTCCAGGG - Intergenic
965380529 3:167982714-167982736 TAGTTTAAATGCTCCTTCCATGG - Intergenic
970055912 4:11971792-11971814 CTGAATAAAGGGTCCTGCCACGG - Intergenic
970354603 4:15239431-15239453 CAGCATAAATGCTGCATCCACGG - Intergenic
971899624 4:32642599-32642621 CAGAATAAATGCTCCTCCAAAGG - Intergenic
972280220 4:37594943-37594965 CAGGATATAGCCTCCTTTCCTGG + Intronic
973290111 4:48462830-48462852 CAAAATAAAGGCTACCTCCATGG - Intergenic
974583150 4:63833209-63833231 CTGAATAAAGACTTCTTCCATGG + Intergenic
974597586 4:64034975-64034997 CAGGATAAAGGATTTTTCCTGGG - Intergenic
974660685 4:64884514-64884536 AAGGATGAAGGGTGCTTCCAAGG - Intergenic
981429071 4:144640036-144640058 CAGGATAAGGGCTCATTGCTGGG - Intergenic
981984769 4:150840491-150840513 CAGGGTAAAGGCCCCTCCCAAGG + Intronic
983600756 4:169524630-169524652 CAGGATAATGGCTACCTGCAGGG + Intronic
983909877 4:173226018-173226040 CAAGATCAAGCCTCCTTCCAGGG - Intronic
984863766 4:184263228-184263250 CTGAAGAAAGGCTCCATCCATGG + Intergenic
984940347 4:184926068-184926090 CAGGATAAGGAATCTTTCCAGGG - Intergenic
985322389 4:188729159-188729181 CAGGATTAAAGCTTCTTCCTTGG - Intergenic
985331777 4:188845130-188845152 CAGGAAAATGGCTCGTTACAGGG - Intergenic
988634070 5:32962667-32962689 CAGGATAGTGGCTCCCTTCAGGG + Intergenic
990285426 5:54296798-54296820 CAGAATTGAGGGTCCTTCCAGGG - Intronic
992158902 5:73981578-73981600 AAGGATAAAGGCTCTTTCTCCGG - Intergenic
997855695 5:137370514-137370536 CAAGAGAAAGGCTCCTTGAAAGG + Intronic
998225736 5:140324950-140324972 AAGGAAAAGGGCTCCTTTCAGGG - Intergenic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
998485683 5:142499894-142499916 CAGGGTAGAGAGTCCTTCCAGGG + Intergenic
1000582239 5:163048619-163048641 CTGGCTTCAGGCTCCTTCCAGGG + Intergenic
1010527540 6:76922363-76922385 CAGGAACAGGGCTCCTGCCAGGG - Intergenic
1012686596 6:102258357-102258379 AAGGAGAAAGGCTCTCTCCAGGG - Intergenic
1015743658 6:136486293-136486315 CAGAATGAAGGCTCCTTCCCTGG + Intronic
1016200633 6:141403201-141403223 CAGGTTAAAGCCTTCTTCCCTGG + Intergenic
1017815365 6:158012317-158012339 CAGGATAATGTCTCCTCTCAAGG - Intronic
1019329522 7:455693-455715 CAGGGAAAAGGCCCCTTCCGGGG - Intergenic
1022290100 7:28993332-28993354 CAGGATAATGGCTCAATACATGG - Intergenic
1022342407 7:29480902-29480924 CAGGATAAAGGCTGTGACCAAGG - Intronic
1022639749 7:32170787-32170809 CAGGAGAAGTCCTCCTTCCAGGG + Intronic
1024562945 7:50660008-50660030 GAGGATAAAGTCATCTTCCAAGG - Intronic
1025265627 7:57454545-57454567 CAGTATAAAGGCTTCTTCCATGG - Intronic
1025767319 7:64467747-64467769 CAGTATAAAGGATTCTTTCATGG - Intergenic
1025775650 7:64558526-64558548 CAGTATAAAGGCTTCTTCCATGG - Intronic
1025778835 7:64581601-64581623 CAGTATAAAGGCTTCTTCCACGG - Intergenic
1025788975 7:64670010-64670032 CAGAATAAAGGCTTCTTCCATGG - Intronic
1025824933 7:65003105-65003127 CAGTATAAAGGCTTCTTCCATGG + Intronic
1025865533 7:65377364-65377386 CAGTATAAAGACTTCTTCTATGG - Intronic
1028718848 7:94005449-94005471 TTGGATAAAGCCTCCTTCCCAGG - Intergenic
1032361923 7:131263944-131263966 CAGGATAAAGGCTATATCCTGGG - Intronic
1033656937 7:143381159-143381181 CAGGATCAGGGCCCCTTCCTGGG + Exonic
1033791134 7:144793281-144793303 AAAGATAATGTCTCCTTCCAGGG + Intronic
1036071908 8:5450008-5450030 ATGGATCCAGGCTCCTTCCATGG - Intergenic
1038520653 8:28229568-28229590 CAGCACAAATGCTGCTTCCAAGG + Intergenic
1038526159 8:28275343-28275365 AAAGATAATGCCTCCTTCCAGGG + Intergenic
1038866823 8:31447675-31447697 CAGGATAATGGCTACCTCTAAGG - Intergenic
1041929461 8:63270933-63270955 CAGGGTAAGGGTTCCTTACATGG + Intergenic
1042816872 8:72887618-72887640 CAGGAGAAGGCTTCCTTCCAAGG + Intronic
1045161158 8:99546308-99546330 CATGATAAAGACTAATTCCAAGG - Intronic
1046775225 8:118157390-118157412 CAGGATAATGGTTACCTCCAGGG + Intergenic
1047334409 8:123922115-123922137 CATGAAAAAGGCTCCTTGCAAGG - Intronic
1047769411 8:128018677-128018699 CAGGATGCAGCCTCCTTCCCAGG - Intergenic
1050572756 9:6958492-6958514 CAGGATAATTGCTCCAACCAGGG + Intronic
1050716506 9:8533215-8533237 AAGGCTACAGGCTCCTTCCAAGG + Intronic
1051441812 9:17092405-17092427 CATGTTAAATGCTCCTTTCATGG - Intergenic
1051967673 9:22848402-22848424 CAAGATAAAGACTGCTTCCAAGG - Intergenic
1052267383 9:26590359-26590381 CAGGATACAGGCTCCCTCCCAGG + Intergenic
1054832761 9:69644766-69644788 CAGAATAAAGTCTGCTTCCAAGG - Intronic
1055029543 9:71759694-71759716 CAAGATAAAGACTACCTCCACGG - Intronic
1056177087 9:84045614-84045636 CAGCATATAGGCTGCTTCCAGGG - Intergenic
1057968691 9:99531456-99531478 CAGGAGAAAGGCTGTTGCCATGG - Intergenic
1058171230 9:101683532-101683554 CATTATAAAGTCTCCTTCCTGGG + Intronic
1060557395 9:124515492-124515514 CAGAATTCAGGCTTCTTCCATGG + Intergenic
1060931252 9:127490915-127490937 CAGGATAAAGGCTTGTGCAATGG - Intronic
1185643166 X:1599567-1599589 GAGGATGACGGCTCCTTCCCGGG + Intronic
1186477719 X:9871357-9871379 CAGAGGAAAGGCTTCTTCCAGGG - Intronic
1187955172 X:24510667-24510689 CAGGATAGAGGCTTCTACCATGG - Intronic
1188187485 X:27132034-27132056 CAGAATAAAGCCTTCTTCCCTGG + Intergenic
1188588315 X:31803563-31803585 CAGGAGAATGGTTACTTCCAGGG - Intronic
1190509076 X:51158489-51158511 AATGATAATGGCTTCTTCCATGG - Intergenic
1191198532 X:57751716-57751738 CAGTTTAAATGCTCCCTCCATGG - Intergenic
1192947504 X:75982031-75982053 CAGGATCAGGTCTCCTGCCAAGG + Intergenic
1196491750 X:116275489-116275511 CATGATAAAGACTCCTACAATGG + Intergenic
1197675902 X:129329583-129329605 CAGAATAAAGGCTCAGTCTAGGG - Intergenic
1198772791 X:140148592-140148614 TAGAATATAGGCACCTTCCAAGG + Intergenic
1199011226 X:142761150-142761172 TAGAATAAAGGCTTCATCCATGG - Intergenic
1199392515 X:147297191-147297213 CAGGATAAAGAATTATTCCATGG + Intergenic
1202346518 Y:23933998-23934020 AAAGATAATGCCTCCTTCCAAGG + Intergenic
1202524253 Y:25736095-25736117 AAAGATAATGCCTCCTTCCAAGG - Intergenic