ID: 1163910592

View in Genome Browser
Species Human (GRCh38)
Location 19:20187851-20187873
Sequence AGGGCATCTCATCACCCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 6, 1: 3, 2: 4, 3: 14, 4: 151}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163910592_1163910602 18 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910602 19:20187892-20187914 GGGGGTGTAGCTTGGTGACAAGG 0: 1
1: 2
2: 14
3: 14
4: 148
1163910592_1163910597 -3 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910597 19:20187871-20187893 CCTCTGAATTTGTAGTGGAGAGG 0: 1
1: 10
2: 10
3: 29
4: 177
1163910592_1163910600 0 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910600 19:20187874-20187896 CTGAATTTGTAGTGGAGAGGGGG 0: 1
1: 1
2: 6
3: 335
4: 13080
1163910592_1163910598 -2 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG 0: 1
1: 12
2: 14
3: 295
4: 12960
1163910592_1163910594 -8 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910594 19:20187866-20187888 GATGCCCTCTGAATTTGTAGTGG 0: 1
1: 1
2: 7
3: 7
4: 85
1163910592_1163910601 10 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910601 19:20187884-20187906 AGTGGAGAGGGGGTGTAGCTTGG 0: 2
1: 2
2: 15
3: 44
4: 369
1163910592_1163910599 -1 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910599 19:20187873-20187895 TCTGAATTTGTAGTGGAGAGGGG 0: 1
1: 11
2: 12
3: 463
4: 18188
1163910592_1163910604 26 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910604 19:20187900-20187922 AGCTTGGTGACAAGGCTGCTGGG 0: 1
1: 16
2: 9
3: 20
4: 153
1163910592_1163910603 25 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910603 19:20187899-20187921 TAGCTTGGTGACAAGGCTGCTGG 0: 1
1: 16
2: 11
3: 22
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163910592 Original CRISPR AGGGCATCTCATCACCCTAA GGG (reversed) Intronic
902368058 1:15990194-15990216 AGGGCATCTCATCATCCCCGTGG + Intergenic
902377106 1:16035066-16035088 AGGGCATCTCTTGACCCTTCGGG - Intergenic
902933936 1:19750849-19750871 AGGGCATCTCAGCAACCTTGGGG - Intronic
906778548 1:48551866-48551888 AGTGCTGCCCATCACCCTAATGG + Intronic
909815786 1:79992116-79992138 AGGTTATCTCTTCACCCTCAGGG - Intergenic
911343915 1:96673923-96673945 GGGGGAACTCATCACCCTGAAGG - Intergenic
911975582 1:104489938-104489960 AGGGAAATTCACCACCCTAAAGG + Intergenic
912153633 1:106888565-106888587 AAGACATCTCATCACCTAAAGGG - Intergenic
915446379 1:155977062-155977084 AGGGCTTTCCATCACCCTTAAGG + Intronic
916341806 1:163745105-163745127 AGGGGATCCCACCACCCTGAAGG - Intergenic
917085056 1:171296731-171296753 AGGCCACCTCATCTCCCTACAGG - Intergenic
919455976 1:197819479-197819501 GGGGAATCTCACCACCCTTAAGG + Intergenic
919602152 1:199635252-199635274 AGGGCATCACATAACAGTAAAGG + Intergenic
923123381 1:231014562-231014584 CTGACATCTCATCATCCTAAGGG + Intergenic
1066035315 10:31475566-31475588 AAGGAAGCTCATCAACCTAATGG + Intronic
1066727597 10:38409411-38409433 AGGGGCTCACATCTCCCTAAGGG + Intergenic
1073221225 10:101875897-101875919 AAGGCATCCAATCACACTAATGG + Intronic
1075676216 10:124297326-124297348 AGGGCAACTCATCACCAACAGGG + Intergenic
1081112133 11:39149297-39149319 AGGGAACCTCATCACCCTGAAGG + Intergenic
1084060584 11:66670856-66670878 AGGGCTTCTCATTACTCTTAAGG + Intronic
1086682054 11:89684016-89684038 AGGGCATCACATAACAGTAAAGG + Intergenic
1088486250 11:110343519-110343541 ATGGCTTCTCATCACACTTAGGG - Intergenic
1088863682 11:113825873-113825895 AGGGCATTCCAGCACCCAAAAGG - Intronic
1088901840 11:114124169-114124191 AGGGCCTCGCATCACACTTACGG - Intronic
1099433857 12:82620128-82620150 GGGGGAGCTCATCACCCTGAAGG + Intergenic
1107311133 13:39079450-39079472 TGGGCATCCCATCACCCAAGTGG - Intergenic
1109961566 13:69638788-69638810 AGGGGATCTCACCACACTCAAGG - Intergenic
1110376803 13:74803141-74803163 AGGGAAACTCACCAACCTAAAGG + Intergenic
1112212656 13:97395935-97395957 CGGGCAGCTAGTCACCCTAAGGG - Intergenic
1112901468 13:104362938-104362960 AGGGGATCTCACTACCCTGAAGG - Intergenic
1114245134 14:20905706-20905728 AGAGGAACTCATCACCCTGAAGG + Intergenic
1116021611 14:39468770-39468792 AGGGGATCCCAGCACCCTGAAGG - Intergenic
1116141021 14:40994728-40994750 GGGGGATCTCACCACCCTGAAGG - Intergenic
1116195603 14:41721736-41721758 AGGGAATCCCATCAGGCTAACGG - Intronic
1116366280 14:44069020-44069042 AGGGAATATCATCACCATGAGGG - Intergenic
1117121328 14:52570746-52570768 AGGGCATTACATAACGCTAAAGG + Intronic
1117264845 14:54076378-54076400 AGGGGACCTTATCACCCTGAAGG - Intergenic
1117606912 14:57439753-57439775 GAGGGAACTCATCACCCTAAAGG - Intergenic
1117648761 14:57880337-57880359 AGGGCTTCTCCTCAACTTAAGGG + Intronic
1122149715 14:99718332-99718354 AGGGCTTCTCAGATCCCTAAAGG + Intronic
1124844200 15:33274912-33274934 AGGGGAACTCACCACCCTGAAGG - Intergenic
1127783359 15:62335277-62335299 TGGGGAGCTCATCACCCTGAAGG - Intergenic
1127919990 15:63486596-63486618 AGAACATTTCATCACCCAAAAGG + Intergenic
1129336448 15:74854737-74854759 AGGGCAGCTGATCACCCTCCCGG + Intronic
1129396009 15:75246945-75246967 TGGGCTTCTCAGTACCCTAAAGG + Intergenic
1130578273 15:85112767-85112789 TGGGCTTCTCCTCACCCCAAAGG + Intronic
1133490434 16:6262848-6262870 AGGCCATCTCACAACCCTCATGG + Intronic
1134568720 16:15273662-15273684 TGGTCATCTCATCACCCTGGGGG - Intergenic
1134733714 16:16482700-16482722 TGGTCATCTCATCACCCTGGGGG + Intergenic
1134933787 16:18229582-18229604 TGGTCATCTCATCACCCTGGGGG - Intergenic
1135358484 16:21790845-21790867 AGGGCATGTGGTCACCCTACTGG - Intergenic
1135456986 16:22606970-22606992 AGGGCATGTGGTCACCCTACTGG - Intergenic
1139588461 16:67919497-67919519 GGGGCATCTGATCATCCTCATGG - Intronic
1139660684 16:68418857-68418879 TGGCCTTCTCATCACCCAAAAGG - Intronic
1140679437 16:77370072-77370094 AGTGCATCTCAACACAATAAAGG + Intronic
1142406002 16:89890244-89890266 AGGTCATTTCCTCACCCCAATGG + Intronic
1143205163 17:5136133-5136155 AGGGCATCTCATCCTCCCCATGG + Intronic
1143282971 17:5768443-5768465 AGGACATTTCATCACCCCACAGG + Intergenic
1146057048 17:29586735-29586757 AGGGCCTCTCCTCACCCCATGGG - Intronic
1148083146 17:44978455-44978477 AGGGAATCTCATGACACTGAGGG - Intergenic
1149075598 17:52594108-52594130 GGGGGATCTCTTCACCCTGAAGG - Intergenic
1150245499 17:63671642-63671664 AGGTGATGTCATCACCGTAATGG + Intronic
1150459234 17:65333382-65333404 AGGGCAACTCAGGGCCCTAAGGG - Intergenic
1152610263 17:81311880-81311902 AGGGCGTCTCATCTCCCCACAGG - Exonic
1154334571 18:13455436-13455458 AGGGCATCTCATGACCTTTACGG - Intronic
1155443498 18:25885608-25885630 AGGGGAACTCATTACCCTGAAGG + Intergenic
1157692103 18:49692046-49692068 CAGGCACCTAATCACCCTAAGGG - Intergenic
1159444523 18:68524572-68524594 AGGACATCTGATCTACCTAATGG + Intergenic
1159542593 18:69797161-69797183 AGGGCTTCTCACCAACCGAAAGG + Intronic
1163041585 19:14606927-14606949 AGGGCAGGTCCTCACCCTGAGGG + Intronic
1163869156 19:19803671-19803693 AGGGAATCTCATCACACTAAGGG + Intronic
1163873567 19:19846261-19846283 AGGGCATCTCCTCACCCTAAGGG + Intergenic
1163877209 19:19882333-19882355 AGAATATCTCATCACCCTAAGGG - Intronic
1163882254 19:19935368-19935390 AGGGCATCTCATCACCCTAAGGG + Exonic
1163901635 19:20106799-20106821 AGGGCATCTCATCACACTAAGGG - Intronic
1163903516 19:20129631-20129653 AGGGCATCTCATCACTCTAAGGG + Intergenic
1163910592 19:20187851-20187873 AGGGCATCTCATCACCCTAAGGG - Intronic
1163912004 19:20203897-20203919 AGGGTTTCTCATCATCCTAAGGG + Intergenic
1163917306 19:20252441-20252463 AGGGCATCTCATCACCCTAAGGG - Intergenic
1163931084 19:20392820-20392842 AGAGCTTATCATCACCCTAAGGG - Intergenic
1163932315 19:20407771-20407793 AGGGTGTCTCATCACCCTAAGGG + Intergenic
1163941400 19:20498351-20498373 AGGGCATCTCATCACCCTAAGGG - Intergenic
1163956301 19:20644492-20644514 AGGGCATCTCATCACCCTAAGGG + Intronic
1163959910 19:20679924-20679946 AGGGCATCTCATAACCCCAAGGG - Intronic
1163974523 19:20837268-20837290 AGGGCATCTCATCACCCTAAGGG + Intronic
1163984930 19:20937381-20937403 AGGGCATCCCGTCACCCTGGGGG - Intronic
1164102928 19:22075060-22075082 AGGGAATCCCATCACCCTGGGGG - Intronic
1164134440 19:22400599-22400621 AGGACATCCCATCACCCTGGGGG + Intronic
1164141168 19:22465848-22465870 AGGGCATCCCATCACCCTGGGGG - Intronic
1164164372 19:22656174-22656196 AGGACATCCCATCACCCTGGGGG - Intronic
1164279112 19:23752717-23752739 AGGGCATCTCATTACCCTGGGGG + Intronic
1164491154 19:28715241-28715263 GGGGGACCTCATCACCCTGAAGG + Intergenic
1166829841 19:45632701-45632723 AGGGCGTGTCCTCACCCCAAGGG - Intronic
1167637548 19:50663633-50663655 AGGGGATCCCATCACCCAGAAGG + Intronic
929610775 2:43269227-43269249 AGGGCTTATCATCACCCACAGGG + Intronic
931035414 2:58236868-58236890 AGGTCATTTCATAATCCTAAAGG + Intronic
932324506 2:70848497-70848519 AAGGCATTCCATCACCCTTAAGG - Intergenic
936925421 2:117731508-117731530 AAGGAAACTCACCACCCTAAAGG + Intergenic
943058564 2:183013693-183013715 ATGGCATCTCAACACACTCAGGG + Intronic
943226717 2:185187611-185187633 AGGGTAACTCACCACCCTGAAGG - Intergenic
1177771392 21:25519777-25519799 TGGGGAACTCACCACCCTAAAGG + Intergenic
1183420840 22:37710438-37710460 AGGGCACCTCAGCACCTGAAGGG - Exonic
949829175 3:8196396-8196418 GGGGGATCTCACCACCCTAAAGG - Intergenic
951279468 3:20731123-20731145 AGGGAAACTCACCACCCTGAAGG - Intergenic
951310209 3:21116592-21116614 AGGGTAACTCATCACCCTAAAGG - Intergenic
951794472 3:26523473-26523495 AGGGGATCTTGCCACCCTAAAGG - Intergenic
953976193 3:47383275-47383297 AGGGCACCTCACCACCCCACAGG - Intronic
954567526 3:51611115-51611137 AGGGTCTCTCATCTCTCTAAGGG - Intronic
954599036 3:51853362-51853384 AGCTCATGTCATCACCCTCATGG + Intergenic
955413105 3:58668489-58668511 AGGGAATCTCATCAGCCGGAAGG - Intergenic
955948254 3:64216234-64216256 AGGGCATCAAGTCACCCGAAAGG - Intronic
956210497 3:66796834-66796856 AGAACATTTCATCACCCAAAAGG - Intergenic
957418729 3:79940063-79940085 ATGGCATGACATGACCCTAATGG - Intergenic
958765250 3:98360237-98360259 AGGGGAACTCATCACCCAGAAGG - Intergenic
959328669 3:104973233-104973255 GGGGGATCTCACCACCCTGAAGG - Intergenic
959408985 3:105997337-105997359 AAGGCAACTCACCACCCTAAAGG - Intergenic
963330618 3:143910671-143910693 GGGGGAGCTCACCACCCTAAAGG + Intergenic
964992820 3:162835373-162835395 AGGGGAACTCATCATCCTAGAGG - Intergenic
970017150 4:11524831-11524853 AGGGCATGTCATCTCTGTAAAGG - Intergenic
970860142 4:20693143-20693165 AGGGAATCTCAGCACCCCATGGG + Intergenic
971760464 4:30758381-30758403 ATGGCATCTCATGACACTTAGGG - Intronic
971891536 4:32529805-32529827 GGGGGACCTCACCACCCTAAAGG + Intergenic
973629289 4:52803762-52803784 AGGGAAGCCCATCACACTAATGG + Intergenic
973641309 4:52905471-52905493 AGGGCATCTCATCTATCTACAGG - Intronic
975629855 4:76388653-76388675 AGGGGATCTTATCACCCTGAAGG + Intronic
979097110 4:116564461-116564483 AGGGAAGCTCATCAGGCTAACGG + Intergenic
981958220 4:150504364-150504386 AGGGAAGCCCATCAGCCTAAAGG + Intronic
985903544 5:2815215-2815237 ACAGCATCTCATCCACCTAATGG - Intergenic
994581019 5:101642030-101642052 AGGGTCTCTCTTCACCCCAAGGG + Intergenic
995136714 5:108686878-108686900 AATGCATCTCATTAGCCTAAAGG + Intergenic
997811644 5:136976318-136976340 ATGGCATCTCATTACCTTACTGG + Exonic
998028587 5:138843336-138843358 AGGACATGTCATCACCATGATGG + Intronic
1010324514 6:74549736-74549758 AGGGGATCTCACTGCCCTAAAGG - Intergenic
1012351706 6:98259545-98259567 AGCCCATCTCAAAACCCTAAGGG - Intergenic
1014692505 6:124578637-124578659 GGGGCAACTCATCACCCTGAAGG + Intronic
1015783494 6:136896371-136896393 AGTGAATGGCATCACCCTAAAGG - Intronic
1016623736 6:146142474-146142496 GGGGGAACTCATCACCCTGAAGG - Intronic
1017223593 6:151994526-151994548 AGGGCATCAGCTCACCCTTACGG - Intronic
1022722789 7:32956460-32956482 AGTGCATCTGATTACTCTAATGG + Intergenic
1023744523 7:43310428-43310450 AAAGCATCTCATCACCTTATTGG - Intronic
1024618198 7:51133573-51133595 CGGGCATCAGATCACCCAAAGGG - Intronic
1026926564 7:74198195-74198217 AGGCCGTTTCACCACCCTAAAGG - Intergenic
1030966374 7:115996999-115997021 GGGGGATCTCATCACCCTGAGGG + Intronic
1032745295 7:134780181-134780203 TTGGCTTCTCATCAACCTAAAGG - Intronic
1039057491 8:33548388-33548410 AAGGCAGCTCATCCTCCTAATGG + Exonic
1039647383 8:39302946-39302968 AGGGAAACTCACCACCCTGAAGG - Intergenic
1040943991 8:52862741-52862763 AGGGCATTACATCACAGTAAAGG - Intergenic
1044496940 8:92897576-92897598 AGGTCAACGCATCATCCTAATGG - Intronic
1046150053 8:110211876-110211898 AGGGGAACACATCACCCTGAAGG + Intergenic
1048846422 8:138607082-138607104 TCGGCATCTGATCACCCTAGCGG - Intronic
1048935308 8:139350300-139350322 TGGGCATCTCACCACCCAGATGG + Intergenic
1049729531 8:144168790-144168812 AGAGAATCTCATCAACCCAAGGG + Intronic
1050145283 9:2560581-2560603 AGGGGAACTCATCACCCTGAAGG + Intergenic
1050997803 9:12241881-12241903 AGGGCCTCTCCTCACCTTTAAGG + Intergenic
1055842569 9:80522991-80523013 AGGGCATTTCATAACGATAAGGG - Intergenic
1056804774 9:89720076-89720098 AGGGCATCTCACCACACCACGGG + Intergenic
1061422809 9:130481221-130481243 AGGGGATCTCAGCTCCCTGAGGG + Intronic
1062488889 9:136794852-136794874 AGGACATCCCAGCACCCTGAGGG + Intronic
1186516158 X:10167300-10167322 TGGCCACCTCATCATCCTAAAGG + Intronic
1186691865 X:11985960-11985982 GGGGGAACTCATCACCCTGAAGG + Intergenic
1186911595 X:14173772-14173794 GGGGGATCTCACCACCCTAAAGG - Intergenic
1189056003 X:37700273-37700295 GGGGCACCTCATCAACCTGATGG - Intronic
1190374263 X:49774210-49774232 GGGGCAGCTCACCACCCTGAAGG - Intergenic
1192406379 X:70890384-70890406 AGGGCATCACCTCACCAAAAAGG + Intronic
1193243046 X:79195223-79195245 GGGGGATCTCACCACCCTGAAGG + Intergenic
1193594859 X:83433749-83433771 AGGGCATTTCATAACATTAAAGG - Intergenic
1193760823 X:85463086-85463108 AGGGCAACTCGCCACCCTTAAGG + Intergenic
1193880077 X:86910928-86910950 GGGGCATATCACCACCCTGAAGG - Intergenic
1194083556 X:89498641-89498663 AGGGCATCCCACTTCCCTAAAGG - Intergenic
1194928766 X:99861856-99861878 AGGGAATCTCATGACTCTGACGG - Intergenic
1195959349 X:110369593-110369615 GGGGCATGTCATCACACTCAAGG + Intronic
1196512025 X:116523389-116523411 GGGGGAACTCACCACCCTAAAGG - Intergenic
1197139198 X:123097248-123097270 AGGGGAACTCACCACCCTGAAGG + Intergenic
1200010077 X:153114238-153114260 AGGGCTCATCATCACCCTGAAGG - Intergenic
1200029523 X:153285684-153285706 AGGGCTCATCATCACCCTGAAGG + Intergenic
1200436204 Y:3154522-3154544 AGGGCATCCCACTTCCCTAAAGG - Intergenic
1200727265 Y:6686619-6686641 AGGGCTCCCCATCACCCTCAGGG - Intergenic
1200728417 Y:6702394-6702416 AGGGCTCCCCATCACCCTCAGGG - Intergenic