ID: 1163910593

View in Genome Browser
Species Human (GRCh38)
Location 19:20187852-20187874
Sequence GAGGGCATCTCATCACCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163910593_1163910602 17 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910602 19:20187892-20187914 GGGGGTGTAGCTTGGTGACAAGG 0: 1
1: 2
2: 14
3: 14
4: 148
1163910593_1163910604 25 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910604 19:20187900-20187922 AGCTTGGTGACAAGGCTGCTGGG 0: 1
1: 16
2: 9
3: 20
4: 153
1163910593_1163910594 -9 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910594 19:20187866-20187888 GATGCCCTCTGAATTTGTAGTGG 0: 1
1: 1
2: 7
3: 7
4: 85
1163910593_1163910600 -1 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910600 19:20187874-20187896 CTGAATTTGTAGTGGAGAGGGGG 0: 1
1: 1
2: 6
3: 335
4: 13080
1163910593_1163910597 -4 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910597 19:20187871-20187893 CCTCTGAATTTGTAGTGGAGAGG 0: 1
1: 10
2: 10
3: 29
4: 177
1163910593_1163910601 9 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910601 19:20187884-20187906 AGTGGAGAGGGGGTGTAGCTTGG 0: 2
1: 2
2: 15
3: 44
4: 369
1163910593_1163910599 -2 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910599 19:20187873-20187895 TCTGAATTTGTAGTGGAGAGGGG 0: 1
1: 11
2: 12
3: 463
4: 18188
1163910593_1163910598 -3 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG 0: 1
1: 12
2: 14
3: 295
4: 12960
1163910593_1163910603 24 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910603 19:20187899-20187921 TAGCTTGGTGACAAGGCTGCTGG 0: 1
1: 16
2: 11
3: 22
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163910593 Original CRISPR GAGGGCATCTCATCACCCTA AGG (reversed) Intronic
No off target data available for this crispr