ID: 1163910598 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:20187872-20187894 |
| Sequence | CTCTGAATTTGTAGTGGAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 13282 | |||
| Summary | {0: 1, 1: 12, 2: 14, 3: 295, 4: 12960} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163910592_1163910598 | -2 | Left | 1163910592 | 19:20187851-20187873 | CCCTTAGGGTGATGAGATGCCCT | 0: 6 1: 3 2: 4 3: 14 4: 151 |
||
| Right | 1163910598 | 19:20187872-20187894 | CTCTGAATTTGTAGTGGAGAGGG | 0: 1 1: 12 2: 14 3: 295 4: 12960 |
||||
| 1163910593_1163910598 | -3 | Left | 1163910593 | 19:20187852-20187874 | CCTTAGGGTGATGAGATGCCCTC | No data | ||
| Right | 1163910598 | 19:20187872-20187894 | CTCTGAATTTGTAGTGGAGAGGG | 0: 1 1: 12 2: 14 3: 295 4: 12960 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163910598 | Original CRISPR | CTCTGAATTTGTAGTGGAGA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||