ID: 1163910598

View in Genome Browser
Species Human (GRCh38)
Location 19:20187872-20187894
Sequence CTCTGAATTTGTAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13282
Summary {0: 1, 1: 12, 2: 14, 3: 295, 4: 12960}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163910592_1163910598 -2 Left 1163910592 19:20187851-20187873 CCCTTAGGGTGATGAGATGCCCT 0: 6
1: 3
2: 4
3: 14
4: 151
Right 1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG 0: 1
1: 12
2: 14
3: 295
4: 12960
1163910593_1163910598 -3 Left 1163910593 19:20187852-20187874 CCTTAGGGTGATGAGATGCCCTC No data
Right 1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG 0: 1
1: 12
2: 14
3: 295
4: 12960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163910598 Original CRISPR CTCTGAATTTGTAGTGGAGA GGG Intronic
Too many off-targets to display for this crispr