ID: 1163911999

View in Genome Browser
Species Human (GRCh38)
Location 19:20203876-20203898
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 11, 1: 3, 2: 10, 3: 38, 4: 836}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163911999_1163912003 -3 Left 1163911999 19:20203876-20203898 CCCTCTTCACTACAAATTCAGAG 0: 11
1: 3
2: 10
3: 38
4: 836
Right 1163912003 19:20203896-20203918 GAGGGTTTCTCATCATCCTAAGG No data
1163911999_1163912004 -2 Left 1163911999 19:20203876-20203898 CCCTCTTCACTACAAATTCAGAG 0: 11
1: 3
2: 10
3: 38
4: 836
Right 1163912004 19:20203897-20203919 AGGGTTTCTCATCATCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163911999 Original CRISPR CTCTGAATTTGTAGTGAAGA GGG (reversed) Intergenic
900736378 1:4301852-4301874 ATCTGTATCTGTAGTAAAGATGG + Intergenic
900758859 1:4456899-4456921 GTTTGAATTTTTAGTAAAGACGG + Intergenic
901036833 1:6341310-6341332 TTCTGTATTTTTAGTAAAGACGG + Intronic
901273013 1:7968135-7968157 CTGTGTATTTTTAGTAAAGATGG - Intronic
901376315 1:8842196-8842218 TTCTGTATTTTTAGTGGAGATGG + Intergenic
903050956 1:20600583-20600605 TTTTTAATTTTTAGTGAAGATGG - Intronic
903418294 1:23199874-23199896 CTTTGTATTTTTAGTAAAGATGG + Intergenic
904126471 1:28243593-28243615 TTTTGTATTTTTAGTGAAGATGG + Intronic
905024071 1:34837895-34837917 CACTGTAATTCTAGTGAAGAAGG + Intronic
905268693 1:36772430-36772452 CTTTGTATTTTTAGTAAAGACGG - Intergenic
905755317 1:40504480-40504502 TTCTGTATTTGTAGTAGAGATGG + Intergenic
905777369 1:40677524-40677546 TTTTGTATTTTTAGTGAAGACGG - Intergenic
906467043 1:46091309-46091331 TTTTGTATTTGTAGTAAAGACGG + Intronic
906619601 1:47265063-47265085 TTTTGTATTTTTAGTGAAGACGG - Intronic
906897108 1:49787328-49787350 TTCTGTATTTTTAGTGGAGACGG - Intronic
907013452 1:50987473-50987495 TTTTGAATTTTTAGTGGAGACGG + Intergenic
908226526 1:62061350-62061372 TTTTGTATTTTTAGTGAAGACGG + Intronic
908267133 1:62390447-62390469 GTCTGAGTTTTCAGTGAAGAAGG - Intergenic
908555025 1:65249070-65249092 CTCTAAATATGAAATGAAGAAGG - Intronic
909962281 1:81861189-81861211 TTCTGTATTTTTAGTAAAGACGG + Intronic
910551132 1:88476539-88476561 TTCTGTATTTTTAGTGGAGATGG - Intergenic
911028371 1:93459102-93459124 TTCTGTATTTTTAGTGGAGACGG - Intronic
911440824 1:97923136-97923158 CAATGAATTTGTAGTTAAAATGG + Intergenic
911573257 1:99543314-99543336 TTCTGTATTTTTAGTAAAGAGGG + Intergenic
911587046 1:99703585-99703607 TTTTGTATTTTTAGTGAAGACGG - Intergenic
911625287 1:100117121-100117143 TTTTGTATTTTTAGTGAAGACGG - Intronic
911724349 1:101226304-101226326 CTTTGTATTTTTAGTGGAGACGG - Intergenic
912245727 1:107960008-107960030 CTCTGAATATATTCTGAAGATGG - Intronic
912377140 1:109219092-109219114 TTTTGAATTTTTAGTGGAGATGG - Intronic
912837586 1:113009936-113009958 TTTTGTATTTGTAGTGGAGAGGG - Intergenic
912923421 1:113891728-113891750 CTTTGTATTTTTAGTGGAGACGG + Intergenic
913307994 1:117452134-117452156 TTCTGTATTTTTAGTAAAGATGG - Intronic
913355509 1:117916861-117916883 TTTTGTATTTTTAGTGAAGATGG - Intronic
913604204 1:120450054-120450076 TTTTGTATTTTTAGTGAAGATGG - Intergenic
913646391 1:120859550-120859572 CTCTGAATTCTTAGTGTTGAGGG - Intergenic
914754525 1:150555158-150555180 TTTTGTATTTGTAGTGGAGATGG + Intronic
915010407 1:152679984-152680006 TTCTGAATTAGGTGTGAAGATGG - Intergenic
915171292 1:153979376-153979398 TTCTGTATTTTTAGTGGAGACGG - Intergenic
915385497 1:155488055-155488077 TTTTGAATTTTTAGTAAAGACGG + Intronic
915398553 1:155605387-155605409 CTCTGAATTTGTAGATGAAATGG + Intergenic
915606110 1:156952195-156952217 GTCTGATTCTGTAGTGATGAAGG - Intronic
915798290 1:158760891-158760913 TTCTATATTTTTAGTGAAGACGG - Intergenic
916015464 1:160745649-160745671 CTCAGCCTTTGTAGTGAAAAAGG + Intronic
916184871 1:162121296-162121318 TTCTGTATTTTTAGTGGAGACGG + Intronic
916303521 1:163302781-163302803 TTCTGAATTTGGTGTGAGGAAGG - Intronic
917108619 1:171521322-171521344 CTATGATTTTGAAGGGAAGAAGG - Intronic
917322021 1:173792499-173792521 CTATGCATTTGTAGAGAAAAAGG + Intergenic
917577542 1:176339815-176339837 CCCTGAATTGGTGATGAAGAGGG + Intergenic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918500155 1:185185875-185185897 TTATGAATTTTGAGTGAAGATGG + Intronic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919076289 1:192817170-192817192 CTGTCTATTTGGAGTGAAGAGGG + Intergenic
919823426 1:201487240-201487262 TTTTGTATTTTTAGTGAAGATGG - Intronic
919965484 1:202519440-202519462 TTCTGTATTTTTAGTAAAGATGG + Intronic
920448790 1:206041202-206041224 TTTTGAATTTGTAGTAGAGACGG + Intronic
921087013 1:211803927-211803949 TTCTGTATTTTTAGTGGAGATGG + Intronic
921817802 1:219583718-219583740 CTTTGTATTTTTAGTAAAGACGG + Intergenic
922171866 1:223162303-223162325 CTCTGAATCTTTATTCAAGATGG - Intergenic
922247047 1:223809994-223810016 TTCTGTATTTTTAGTGGAGATGG + Intronic
922335348 1:224614774-224614796 CTTTGTATTTTTAGTAAAGACGG - Intronic
922474044 1:225894299-225894321 CTTTTCATTTGTATTGAAGATGG + Intronic
922690606 1:227686385-227686407 TTTTGTATTTTTAGTGAAGATGG + Intergenic
923393389 1:233536070-233536092 CTCTAAATTTGCAATTAAGAGGG - Intergenic
923861850 1:237899528-237899550 CTCTGTATTTTTAGTAGAGACGG + Intergenic
924091939 1:240510195-240510217 CTTTGTATTTTTAGTGGAGACGG - Intronic
924304609 1:242674348-242674370 TTTTGTATTTTTAGTGAAGACGG + Intergenic
924521407 1:244809421-244809443 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1063274631 10:4551956-4551978 CTATTAATTTATAGTCAAGAGGG + Intergenic
1063365534 10:5488194-5488216 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1063501690 10:6560865-6560887 TTTTGTATTTTTAGTGAAGATGG - Intronic
1063524227 10:6769510-6769532 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1063625961 10:7690379-7690401 GTCTGAATTTGTAGTGTTGCAGG - Intergenic
1063700593 10:8380850-8380872 TTTTGTATTTGTAGTGGAGACGG - Intergenic
1064082824 10:12322321-12322343 TTTTGTATTTGTAGTAAAGATGG - Intergenic
1064196272 10:13246326-13246348 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1064205767 10:13322314-13322336 TTTTGTATTTTTAGTGAAGATGG + Intronic
1064263559 10:13806026-13806048 TTCTGTATTTTTAGTGGAGACGG + Intronic
1064267388 10:13836166-13836188 TTCTGTATTTGTAGTAGAGACGG + Intronic
1064428282 10:15249264-15249286 TTTTGTATTTTTAGTGAAGATGG + Intronic
1065513227 10:26500311-26500333 CTGTGACTTTGGGGTGAAGACGG - Intronic
1065534649 10:26705642-26705664 TTTTGTATTTTTAGTGAAGACGG + Intronic
1065756677 10:28936912-28936934 CTTTGTATTTTTAGTAAAGATGG + Intergenic
1066366659 10:34783430-34783452 TTTTGTATTTTTAGTGAAGACGG - Intronic
1066574012 10:36805806-36805828 TTTTGAATTTTTAGTAAAGATGG + Intergenic
1066637188 10:37515835-37515857 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1066976309 10:42371055-42371077 TTTTGTATTTTTAGTGAAGAAGG - Intergenic
1067003950 10:42643604-42643626 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1067117635 10:43447410-43447432 TTCTGTATTTTTAGTAAAGACGG + Intronic
1067384953 10:45810512-45810534 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1067674222 10:48356669-48356691 TTTTGTATTTTTAGTGAAGACGG - Intronic
1068513121 10:57991649-57991671 CTTTGTATTTTTAGTAAAGATGG - Intergenic
1069382009 10:67850902-67850924 CTTTGTATTTTTAGTGGAGACGG - Intergenic
1069521661 10:69126289-69126311 TTTTGTATTTTTAGTGAAGACGG - Intronic
1069596393 10:69674431-69674453 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1070031366 10:72680448-72680470 CTTTGTATTTTTAGTAAAGATGG + Intergenic
1070334426 10:75441454-75441476 AGCTGAAGGTGTAGTGAAGAGGG + Intronic
1070615419 10:77966146-77966168 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1071812473 10:89198536-89198558 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1072128023 10:92464838-92464860 CTTTGTATTTTTAGTAAAGATGG + Intronic
1072330357 10:94342912-94342934 TTCTGTATTTTTAGTAAAGATGG - Intronic
1072664324 10:97382930-97382952 TTTTGTATTTTTAGTGAAGATGG + Intronic
1073172187 10:101519823-101519845 TTCTGTATTTTTAGTAAAGACGG - Intronic
1074052121 10:109889371-109889393 TTCTGTATTTTTAGTAAAGACGG + Intronic
1074126831 10:110535272-110535294 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1074288174 10:112118177-112118199 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1074495357 10:113975585-113975607 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1074752551 10:116600665-116600687 CTCTGAATTTGGAGTTGGGAAGG - Intronic
1074822285 10:117189513-117189535 TTTTGAATTTTTAGTGGAGATGG - Intergenic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1075130389 10:119733061-119733083 CTATCACTTTGTAGTCAAGAAGG - Intronic
1075327597 10:121547052-121547074 CTTTGTATTTTTAGTGGAGATGG - Intronic
1075873047 10:125784857-125784879 TTCTGAATTTTTAGTAGAGATGG + Intergenic
1075906542 10:126086503-126086525 CTTTGTATTTTTAGTGGAGATGG - Intronic
1075953893 10:126505782-126505804 TTCTGTATTTTTAGTGGAGACGG - Intronic
1076076804 10:127539738-127539760 CTCTGAATTTGTTTTTAAGAAGG - Intergenic
1076762869 10:132614293-132614315 TTTTGTATTTGTAGTAAAGACGG - Intronic
1077572264 11:3349788-3349810 TTCTGTATTTTTAGTAAAGATGG + Intronic
1077826621 11:5816708-5816730 CTTTGTATTTTTAGTGGAGACGG + Intronic
1078278941 11:9879911-9879933 TTTTGTATTTTTAGTGAAGACGG - Intronic
1078846502 11:15123591-15123613 ATCTTAATTTGTACAGAAGATGG - Intronic
1079194581 11:18314356-18314378 TTTTGAATTTTTAGTGGAGACGG - Intronic
1079221983 11:18571173-18571195 TTTTGAATTTTTAGTGGAGATGG - Intronic
1079231842 11:18655850-18655872 TTTTGGATTTTTAGTGAAGATGG - Intergenic
1079291642 11:19193527-19193549 CTCTGTATTTTTAGTAGAGACGG + Intronic
1079467311 11:20743181-20743203 CTTTGTATTTTTAGTGGAGATGG - Intronic
1079986167 11:27202843-27202865 CTTTGTATTTTTAGTAAAGACGG - Intergenic
1080007455 11:27424916-27424938 CTTTGTATTTGTAGTAGAGACGG + Intronic
1080121884 11:28687199-28687221 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1080631365 11:34080093-34080115 TTTTGAATTTTTAGTAAAGACGG + Intronic
1081257028 11:40910534-40910556 TTCTGAATTTTTAATGAATATGG - Intronic
1081640252 11:44748235-44748257 TTCTGTATTTTTAGTAAAGATGG - Intronic
1081890124 11:46534320-46534342 TTCTGTATTTTTAGTAAAGACGG - Intronic
1081896596 11:46592585-46592607 TTTTGTATTTGTAGTAAAGACGG - Intronic
1082022885 11:47549985-47550007 TTCTGTATTTTTAGTGGAGATGG + Intronic
1082061720 11:47866787-47866809 TTCTGTATTTGTAGTAGAGACGG - Intergenic
1082079778 11:48003664-48003686 TTTTGTATTTGTAGTAAAGATGG + Intronic
1083043852 11:59714270-59714292 TTTTGAATTTTTAGTAAAGATGG + Intronic
1083054263 11:59804661-59804683 CTCTTAATCTGTGGAGAAGATGG + Intergenic
1083455597 11:62776678-62776700 TTCTGTATTTTTAGTAAAGAAGG - Intronic
1083456173 11:62780146-62780168 TTTTGTATTTTTAGTGAAGATGG - Intronic
1083883967 11:65561905-65561927 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1084201129 11:67559207-67559229 TTTTGAATTTTTAGTGGAGACGG + Intergenic
1085404912 11:76256046-76256068 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1085940942 11:81206159-81206181 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1085989777 11:81827895-81827917 CTCTGTATTTTTAGTGGAGACGG + Intergenic
1086246166 11:84755593-84755615 CTTTGTATTTTTAGTGGAGACGG + Intronic
1086333601 11:85777987-85778009 TTTTGTATTTTTAGTGAAGATGG + Intronic
1086466033 11:87054262-87054284 TTTTGTATTTTTAGTGAAGATGG - Intronic
1087292424 11:96334600-96334622 CTTTGAATTTACAGTGTAGACGG - Intronic
1087408916 11:97765971-97765993 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1087778766 11:102281658-102281680 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1087899610 11:103626076-103626098 AACTGAATTTGCAGAGAAGACGG + Intergenic
1088028731 11:105219772-105219794 GTCTGTATTTATAGTGGAGACGG - Intergenic
1088090172 11:106028794-106028816 CCCTGAATATTTAGTGAAAATGG + Intergenic
1088152500 11:106761814-106761836 CTCTTACTTTGTGGTTAAGAAGG - Intronic
1088201147 11:107336315-107336337 TTTTGTATTTTTAGTGAAGATGG + Intronic
1089249458 11:117147096-117147118 TTTTGTATTTTTAGTGAAGACGG - Intronic
1089453970 11:118615022-118615044 TTTTGTATTTGTAGTGGAGATGG - Intronic
1089855724 11:121543003-121543025 ATTTGTATTTGTAGTAAAGACGG - Intronic
1091241939 11:134058854-134058876 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1091644846 12:2265599-2265621 CCCTGCATTTGCAGGGAAGATGG - Intronic
1092180914 12:6446124-6446146 TTCTGAAATTGTAGCGAAGATGG - Intronic
1092758162 12:11784257-11784279 TTTTGTATTTTTAGTGAAGACGG - Intronic
1092823566 12:12375973-12375995 TTCTGTATTTTTAGTGGAGATGG + Intronic
1092888050 12:12942562-12942584 TTTTGTATTTTTAGTGAAGACGG - Intronic
1093240589 12:16666452-16666474 TTTTGAATTTTTAGTAAAGATGG - Intergenic
1093827647 12:23713919-23713941 TTTTGAATTTTTAGTAAAGAAGG - Intronic
1094225351 12:28039441-28039463 TTCTGAATTTTTAGTAGAGACGG - Intergenic
1094485342 12:30922226-30922248 CTTTGTATTTTTAGTAAAGATGG - Intergenic
1095181253 12:39148966-39148988 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1096828498 12:54297182-54297204 TTCTGCATTTTTAGTGGAGATGG - Intronic
1097852504 12:64426677-64426699 CCCTGAATTTAAAATGAAGATGG + Intronic
1097952350 12:65445814-65445836 TTCTGTATTTTTAGTAAAGATGG + Intronic
1099455547 12:82858392-82858414 CTTTGACTTTGGCGTGAAGACGG + Intronic
1099705025 12:86141149-86141171 CTCTGAATTTGTTGATCAGATGG - Intronic
1099849444 12:88074052-88074074 TTTTGAATTTTTAGTAAAGATGG - Intronic
1100479065 12:94960469-94960491 TTTTGAATTTTTAGTAAAGACGG + Intronic
1100882807 12:99037342-99037364 TTCTGTATTTTTAGTCAAGATGG - Intronic
1102104860 12:110312677-110312699 TTTTGTATTTTTAGTGAAGATGG - Intronic
1102109257 12:110351957-110351979 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1103112400 12:118291983-118292005 TTTTGTATTTTTAGTGAAGACGG + Intronic
1103603818 12:122071961-122071983 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1103630538 12:122256401-122256423 TTTTGTATTTGTAGTGGAGATGG - Intronic
1103766769 12:123285833-123285855 CTCTGTATTTTTAGTAAAGATGG - Intergenic
1104117127 12:125760413-125760435 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1104426293 12:128681149-128681171 CTTTGCATTTTTAGTAAAGATGG + Intronic
1104451487 12:128872324-128872346 CACTGCATTTATAGGGAAGATGG - Intronic
1104453782 12:128893072-128893094 TTTTGTATTTTTAGTGAAGACGG - Intronic
1104453838 12:128893754-128893776 TTTTGTATTTTTAGTGAAGATGG + Intronic
1105010433 12:132752539-132752561 TTCTGTATTTTTAGTAAAGACGG + Intronic
1105058788 12:133129329-133129351 TTCTGTATTTTTAGTGGAGATGG - Intronic
1106557521 13:30822929-30822951 GTCTGAATATGTGGTGAGGAAGG - Intergenic
1106608039 13:31250342-31250364 TTTTGAATTTTTAGTAAAGATGG + Intronic
1107480916 13:40785694-40785716 TTTTGAATTTTTAGTGGAGACGG + Intergenic
1107728819 13:43327569-43327591 TTCTAAATTTTTAGTTAAGAAGG + Intronic
1108115081 13:47118715-47118737 CTATGAATTTGGAGAGAACATGG - Intergenic
1108119315 13:47166008-47166030 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1108122195 13:47201360-47201382 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1108162425 13:47655683-47655705 CTCTTAATTAGTCCTGAAGAGGG - Intergenic
1108683835 13:52802279-52802301 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1108945000 13:56011264-56011286 CTCTAAATTTGAAGTGAGAAGGG - Intergenic
1109830779 13:67784574-67784596 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1109905552 13:68835686-68835708 CTAGGAATTTGCAGTGAAAAGGG + Intergenic
1110815871 13:79859357-79859379 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1110944705 13:81397616-81397638 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1111885320 13:94013518-94013540 TTTTGTATTTGTAGTGGAGACGG + Intronic
1111947423 13:94680434-94680456 TTTTGTATTTCTAGTGAAGACGG - Intergenic
1112057577 13:95705020-95705042 CTCTGTATTTTTAGTAGAGATGG + Intronic
1112301196 13:98231998-98232020 CTTTGTATTTTTAGTAAAGATGG + Intronic
1113326676 13:109289032-109289054 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1114448333 14:22807069-22807091 TTCTGTATTTTTAGTAAAGACGG + Intronic
1114506692 14:23220651-23220673 TTCTGTATTTTTAGTAAAGATGG - Intronic
1115010796 14:28542280-28542302 CTCTGCCTTTGTAGTGTAAAAGG - Intergenic
1115160914 14:30392827-30392849 TTCTGAATTTTTAGTAGAGACGG + Intergenic
1115669046 14:35588075-35588097 TTTTGAATTTTTAGTAAAGACGG + Intronic
1116149806 14:41126602-41126624 TTCTGTATTTTTAGTAAAGAAGG + Intergenic
1116242969 14:42370427-42370449 ATATGAATTTGTGGTGAAGGGGG - Intergenic
1117731781 14:58729852-58729874 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1118028153 14:61791676-61791698 TTCTGTATTTGTAGTAGAGATGG - Intronic
1118264910 14:64285655-64285677 TTTTGTATTTTTAGTGAAGATGG - Intronic
1119073235 14:71608722-71608744 CTCTGTATTTTTAGTAGAGACGG - Intronic
1119073331 14:71609635-71609657 TTTTGAATTTTTAGTGGAGAAGG + Intronic
1119466560 14:74863155-74863177 CTCAGAATCTCTAGTGAAGCTGG + Exonic
1119584595 14:75821439-75821461 CTCTGAATTTAAAATGAAAATGG - Intronic
1119683408 14:76610393-76610415 CTTTGTATTTGTAGTAGAGATGG + Intergenic
1119847066 14:77838566-77838588 TTTTGTATTTGTAGTAAAGATGG + Intronic
1120004500 14:79341622-79341644 CTCTGAATTTGGAGTTCACATGG - Intronic
1120416059 14:84219746-84219768 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1120472908 14:84949400-84949422 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1121506754 14:94483554-94483576 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1121650585 14:95554956-95554978 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1121805048 14:96811099-96811121 TTTTGAATTTTTAGTGGAGATGG + Intronic
1121883036 14:97517312-97517334 TTCTTAATTTGTAAAGAAGAGGG - Intergenic
1122241553 14:100371562-100371584 TTTTGTATTTTTAGTGAAGATGG - Intronic
1124115209 15:26835256-26835278 CACTGAATCTGTAGTGAATATGG + Intronic
1124471804 15:29994116-29994138 ATCTGAAGTAATAGTGAAGATGG - Intergenic
1125350372 15:38760441-38760463 CTATGAAAGTGTAGAGAAGATGG + Intergenic
1125431482 15:39599093-39599115 TTCTGTATTTTTAGTAAAGACGG + Exonic
1126838001 15:52687231-52687253 TTTTGTATTTGTAGTGGAGATGG - Intronic
1127111910 15:55683369-55683391 GTGTGCATTTGTAGTAAAGAGGG + Intronic
1127292411 15:57582189-57582211 CTCTGAGGTTGCAGTGAAGCAGG + Intergenic
1127506862 15:59606287-59606309 TTTTGAATTTTTAGTGGAGACGG - Intronic
1128404671 15:67323412-67323434 TTTTGTATTTTTAGTGAAGACGG + Intronic
1128436835 15:67660493-67660515 CTCTGAAAGTGTACTGAAGATGG + Intronic
1128505402 15:68267368-68267390 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1128602663 15:69010961-69010983 CTTTGAATTTTTAGTAGAGATGG - Intronic
1128903934 15:71451005-71451027 CTCTGCATTTTTAGTGGAGACGG - Intronic
1129406210 15:75320258-75320280 TTCTGAATTTTTAGTAGAGATGG - Intergenic
1129435872 15:75539839-75539861 CTTTGTATTTTTAGTGGAGACGG + Intronic
1129779435 15:78260395-78260417 CTCTGAATTGGAAGGGAAGCAGG - Intergenic
1130525422 15:84701894-84701916 TTGTGTATTTTTAGTGAAGATGG - Intronic
1130870738 15:87969952-87969974 CTCTGAATATGTTGTGTATAAGG - Intronic
1131833202 15:96367178-96367200 CTTTGAAGTTAGAGTGAAGATGG - Intergenic
1132095485 15:98981318-98981340 CTTTGTATTTTTAGTGGAGACGG - Intronic
1132103029 15:99040802-99040824 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1133478965 16:6151003-6151025 TTCTGAATCTGTAAGGAAGAAGG - Intronic
1133553508 16:6882422-6882444 TTTTGTATTTTTAGTGAAGATGG - Intronic
1133614236 16:7461336-7461358 TTTTGTATTTTTAGTGAAGATGG + Intronic
1133649660 16:7799736-7799758 ATCTGCATTTATAGTGAATAGGG + Intergenic
1133941322 16:10311541-10311563 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1133942834 16:10324702-10324724 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1135029869 16:19029883-19029905 TTTTGTATTTTTAGTGAAGACGG + Intronic
1135031666 16:19043740-19043762 TTTTGTATTTGTAGTGGAGACGG + Intronic
1135450335 16:22551884-22551906 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1135771860 16:25223995-25224017 TTTTGTATTTGTAGTGGAGATGG + Intronic
1136423433 16:30152208-30152230 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1136503196 16:30684943-30684965 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1137532483 16:49288246-49288268 ATCTGAATCTGTAATAAAGAAGG - Intergenic
1137543837 16:49384176-49384198 CTTTGTATTTTTAGTAAAGATGG - Intronic
1137700323 16:50493266-50493288 TTTTGAATTTTTAGTAAAGACGG + Intergenic
1137714091 16:50587226-50587248 TTCTGATTTTGTAGGGTAGATGG + Intronic
1138009841 16:53368127-53368149 TTTTAAATTTGTAGTGGAGACGG + Intergenic
1138034839 16:53593818-53593840 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1138059645 16:53876754-53876776 TTTTGAATTTTTAGTAAAGACGG - Intronic
1138313633 16:56049660-56049682 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1138587456 16:57979895-57979917 TTTTGTATTTTTAGTGAAGATGG - Intronic
1138704263 16:58898316-58898338 TTCTGAATTTTTAGTGGAGATGG + Intergenic
1139207912 16:65046935-65046957 TTCTGTATTTTTAGTAAAGATGG - Intronic
1139500459 16:67359950-67359972 TTTTGTATTTTTAGTGAAGATGG - Intronic
1139538735 16:67597507-67597529 TTCTGTATTTTTAGTGGAGACGG + Intronic
1140641311 16:76976679-76976701 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1141013370 16:80424330-80424352 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1141045145 16:80709209-80709231 TTTTGTATTTGTAGTGGAGACGG - Intronic
1141086345 16:81098163-81098185 CTTTGGATTTGTAGTAGAGACGG - Intergenic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1141180190 16:81747362-81747384 TTCTGTATTTTTAGTAAAGATGG - Intronic
1141250453 16:82352036-82352058 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1141352328 16:83309545-83309567 TTTTGTATTTTTAGTGAAGATGG + Intronic
1141440445 16:84026395-84026417 TTTTGTATTTTTAGTGAAGATGG + Intronic
1141487553 16:84350938-84350960 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1142705865 17:1693837-1693859 CTTTGTATTTTTAGTAAAGATGG - Intergenic
1143062184 17:4211231-4211253 TTTTGTATTTGTAGTAAAGACGG - Intronic
1143220565 17:5257907-5257929 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1143262160 17:5607489-5607511 TTTTGTATTTTTAGTGAAGATGG + Intronic
1143831241 17:9653415-9653437 TTTTGAATTTTTAGTAAAGATGG - Intronic
1143947746 17:10608991-10609013 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1144249039 17:13397066-13397088 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1144465584 17:15494187-15494209 CTCTGTATTTTTAGTAGAGATGG - Intronic
1144886361 17:18465393-18465415 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1145145845 17:20478918-20478940 TTTTGAATTTTTAGTGGAGATGG - Intergenic
1145740014 17:27265937-27265959 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1146227760 17:31081805-31081827 TTCTGTATTTTTAGTAAAGAAGG + Intergenic
1146441751 17:32902666-32902688 TTTTGAATTTTTAGTAAAGATGG - Intergenic
1146616175 17:34359006-34359028 CTCAGGATTGGTAGGGAAGAGGG + Intergenic
1147954668 17:44125720-44125742 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1148390748 17:47270672-47270694 TTCTGAAGTTGTAGTCAAGTCGG + Intronic
1148530954 17:48390902-48390924 TTTTGTATTTTTAGTGAAGACGG - Intronic
1148634599 17:49138704-49138726 CTTTGTATTTTTAGTGGAGACGG - Intronic
1148929041 17:51113181-51113203 TTTTGTATTTGTAGTAAAGATGG - Intronic
1149019126 17:51943233-51943255 CTCTGGATTTCTAGAGAAGCTGG + Intronic
1149935087 17:60797064-60797086 CTCTGTATTTTTAGTAGAGATGG + Intronic
1150076916 17:62200424-62200446 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1150419267 17:65016530-65016552 CTTTGTATTTCTAGTAAAGACGG + Intronic
1150601983 17:66659061-66659083 ATCTGAATTTGCAGAGGAGAGGG - Intronic
1151282391 17:73086647-73086669 TTTTGTATTTGTAGTGGAGATGG - Intronic
1151332382 17:73418176-73418198 TTTTGTATTTTTAGTGAAGATGG + Intronic
1151367670 17:73627875-73627897 TTTTGTATTTGTAGTGGAGACGG - Intronic
1151507032 17:74535294-74535316 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1151617340 17:75222213-75222235 TTTTGTATTTGTAGTGGAGACGG + Intronic
1151640763 17:75391634-75391656 TTTTGAATTTTTAGTGGAGATGG - Intronic
1151829181 17:76539695-76539717 CTCTGAATTTGCAGTGCACAAGG - Intronic
1151931229 17:77232972-77232994 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1151967779 17:77440562-77440584 CTCTGAATTGGAAGAGAAAAAGG - Intronic
1152259033 17:79256745-79256767 TTTTGAATTTTTAGTGGAGATGG - Intronic
1152270350 17:79320910-79320932 CTCTGAATGTGCAGGGAAGGTGG - Intronic
1154238889 18:12633404-12633426 TTTTGTATTTTTAGTGAAGACGG - Intronic
1154986912 18:21561596-21561618 CTTTGTATTTTTAGTAAAGATGG + Intronic
1155002256 18:21698749-21698771 CTCTGTATTTTTAGTGTAGATGG + Intronic
1155285623 18:24285984-24286006 TTTTGTATTTGTAGTGGAGATGG - Intronic
1156151038 18:34243243-34243265 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1157210038 18:45734514-45734536 CTCTGAATGTATAGTGGTGATGG + Intronic
1157316247 18:46592388-46592410 CTCTGTATTTATTGTGAATAGGG - Intronic
1157885252 18:51360320-51360342 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1158384389 18:56973036-56973058 CTTTGTATTTTTAGTGGAGACGG + Intronic
1159252306 18:65895527-65895549 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1159420891 18:68218140-68218162 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1159439759 18:68462920-68462942 CTCAGACTGTTTAGTGAAGATGG - Intergenic
1159774349 18:72585927-72585949 CTCTGATTTTGGAGTAAAGTTGG - Intronic
1159898918 18:74023639-74023661 ATCTGCATCTGAAGTGAAGAGGG - Intergenic
1160127764 18:76194067-76194089 CTCTGAAATTGCAGTCAAGTGGG + Intergenic
1161232647 19:3182351-3182373 CTTTGTATTTTTAGTAAAGATGG - Intergenic
1161312329 19:3601754-3601776 TTTTGTATTTTTAGTGAAGATGG - Intronic
1161499584 19:4606602-4606624 TTCTGAATTTTTAGTAGAGACGG - Intergenic
1161845402 19:6709275-6709297 TTTTGTATTTTTAGTGAAGACGG - Intronic
1161953368 19:7479624-7479646 CTCTGGATTTGCAGTGAGCAGGG - Intronic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1162212793 19:9106245-9106267 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1162256760 19:9496763-9496785 TTTTGTATTTGTAGTGGAGATGG - Intronic
1162700211 19:12509371-12509393 TTCTGTATTTTTAGTAAAGACGG + Intronic
1162817616 19:13205883-13205905 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1162841609 19:13360646-13360668 CTTTGTATTTTTAGTGGAGATGG + Intronic
1162892040 19:13740705-13740727 CTTTGTATTTTTAGTGGAGATGG + Intronic
1162894285 19:13755783-13755805 TTTTGTATTTGTAGTAAAGACGG - Intronic
1162942730 19:14023159-14023181 CTCTGAGTTCATTGTGAAGATGG - Intergenic
1163071868 19:14849626-14849648 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1163334865 19:16664243-16664265 TTTTGCATTTGTAGTGGAGACGG - Intronic
1163604771 19:18267966-18267988 TTCTGTATTTTTAGTAAAGACGG + Intronic
1163816792 19:19471083-19471105 TTCTGTATTTTTAGTGGAGACGG - Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163873560 19:19846240-19846262 CTCTGAATTGGTAGTGGAGAGGG - Intergenic
1163877212 19:19882354-19882376 CTGTGAATTTTTAGTGAAGAGGG + Intronic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1163901640 19:20106820-20106842 CTCTGAATTGATAGTGAAGAGGG + Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163905062 19:20145025-20145047 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1165162707 19:33827193-33827215 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1165683409 19:37796954-37796976 CATTGTATTTGTAGTGGAGACGG + Intronic
1165717709 19:38057098-38057120 TTTTGTATTTGTAGTAAAGACGG - Intronic
1166013494 19:39961476-39961498 TTCTGAATTTTTAGTAGAGATGG + Intergenic
1166600301 19:44088081-44088103 TTTTGTATTTTTAGTGAAGATGG + Exonic
1167013454 19:46824022-46824044 CTTTGAATTTTTAGTAGAGATGG - Intergenic
1167047914 19:47061991-47062013 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1167068164 19:47202739-47202761 CTCTGAATTTTTAGTAGAGACGG - Intronic
1167088597 19:47327862-47327884 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1167205719 19:48100344-48100366 TTCTGTATTTTTAGTGGAGACGG - Intronic
1167551656 19:50165456-50165478 TTCTGAATTTTTAGTAGAGATGG + Intergenic
1167910223 19:52695813-52695835 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1167918015 19:52757954-52757976 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1168040582 19:53755529-53755551 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1168341961 19:55629618-55629640 TTTTGTATTTGTAGTGGAGACGG - Intergenic
925311321 2:2885536-2885558 TTCTGTATTTTTAGTAAAGACGG - Intergenic
925707361 2:6699228-6699250 TTTTGTATTTGTAGTAAAGATGG - Intergenic
925952068 2:8924167-8924189 CTCTGAATCTTGTGTGAAGATGG - Intronic
925972361 2:9114664-9114686 CTCTGAATTATTACTGAAGCTGG - Intergenic
925990775 2:9252408-9252430 TTCTGTATTTTTAGTAAAGATGG - Intronic
926344723 2:11934844-11934866 CTCTGAATTGGGAGGAAAGATGG + Intergenic
926445831 2:12941983-12942005 TTCTGTATTTTTAGTGGAGATGG - Intergenic
928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG + Intronic
928045619 2:27928318-27928340 TTTTGAATTTTTAGTAAAGATGG + Intronic
928342924 2:30461109-30461131 CTCTGAATTTGTAGCCAAGTTGG + Intronic
928516535 2:32049808-32049830 TTCTGTATTTTTAGTGGAGACGG + Intergenic
928520933 2:32088056-32088078 TTTTGTATTTTTAGTGAAGATGG + Intronic
928931618 2:36630907-36630929 CTCAGAATTTGGTGTGAAAATGG - Intronic
929183596 2:39069716-39069738 TTCTGTATTTTTAGTGGAGACGG + Intronic
929199226 2:39217901-39217923 CTTTGTATTTTTAGTAAAGATGG + Intronic
929205233 2:39284329-39284351 TTCTGTATTTGTAGTAGAGATGG + Intronic
929305975 2:40362063-40362085 CTCTGTATTTTTAGTAGAGATGG + Intronic
929509386 2:42554978-42555000 TTTTGTATTTTTAGTGAAGACGG - Intronic
929607077 2:43241838-43241860 CTGTGAAATGGTACTGAAGAAGG + Intronic
929744117 2:44637892-44637914 TTTTGTATTTGTAGTGGAGATGG - Intronic
929928217 2:46232412-46232434 CTTTGAATTTTTAGTAGAGATGG + Intergenic
930252270 2:49048054-49048076 TTCTGAATTTTTAGTAGAGATGG + Intronic
930606093 2:53494688-53494710 CTCTAAATTTTTAGAGAAAAAGG - Intergenic
930952727 2:57162978-57163000 TTCTGTATTTTTAGTAAAGACGG - Intergenic
931173073 2:59825523-59825545 ACTTGCATTTGTAGTGAAGAAGG - Intergenic
931435473 2:62242053-62242075 TTTTGTATTTGTAGTGGAGACGG - Intergenic
931451066 2:62368168-62368190 CTTTGTATTTTTAGTAAAGATGG + Intergenic
931611579 2:64107097-64107119 TTTTGTATTTTTAGTGAAGATGG + Intronic
931623753 2:64236548-64236570 TTCTGTATTTTTAGTGGAGATGG - Intergenic
931717577 2:65041291-65041313 TTCTGAATTTTTAGTAGAGACGG - Intergenic
931859629 2:66341311-66341333 TTCTGTATTTTTAGTAAAGATGG + Intergenic
932004627 2:67915984-67916006 TTCTGAATTTTCAGTGAAAAGGG - Intergenic
932183917 2:69675092-69675114 TTCTGTATTTGTAGTAGAGACGG + Intronic
933107459 2:78349919-78349941 CTCTGAATTTGAGGAAAAGAAGG + Intergenic
933188073 2:79301246-79301268 CTCTGCCTTCGTAGTGTAGAAGG - Intronic
934715523 2:96540913-96540935 TTTTGTATTTGTAGTGGAGATGG + Intronic
935065412 2:99643228-99643250 TTTTGAATTTTTAGTAAAGATGG + Intronic
935118794 2:100161579-100161601 TTCTGTATTTTTAGTGGAGATGG - Intergenic
935209750 2:100929073-100929095 TTTTGTATTTTTAGTGAAGACGG + Intronic
935790762 2:106587934-106587956 TTTTGTATTTTTAGTGAAGACGG - Intergenic
935953515 2:108352323-108352345 TTGTCAATTTGTAGTGAAAATGG - Intergenic
936796788 2:116215665-116215687 CTTTGTATTTTTAGTAAAGAGGG + Intergenic
937105607 2:119309588-119309610 TTTTGTATTTTTAGTGAAGATGG + Intronic
937374280 2:121324758-121324780 CTTTGTATTTTTAGTGGAGACGG - Intergenic
937416079 2:121715620-121715642 CTCTGTATTTTTAGTAGAGACGG - Intergenic
937645492 2:124261804-124261826 TGCTGTATTTGTAGTGAAAAGGG + Intronic
937744901 2:125400713-125400735 GTTTGCATTTGTAGTGAACATGG - Intergenic
938169895 2:129066010-129066032 CTGGAAGTTTGTAGTGAAGAAGG - Intergenic
938602198 2:132853893-132853915 CTGTGTATTTAAAGTGAAGAAGG - Intronic
938887837 2:135671537-135671559 TTTTGTATTTGTAGTGGAGATGG + Intronic
940229142 2:151431615-151431637 CTTTGTATTTTTAGTAAAGATGG - Intronic
940843839 2:158618010-158618032 TTCTGTATTTTTAGTAAAGATGG - Intronic
940957591 2:159745482-159745504 TTTTGTATTTTTAGTGAAGATGG - Intronic
941128456 2:161616333-161616355 CTATGAAGCTGTAGTGAGGAGGG - Intronic
941676008 2:168344209-168344231 TTCTGTATTTTTAGTAAAGATGG - Intergenic
941797390 2:169615217-169615239 TTCTGTATTTTTAGTGGAGATGG + Intronic
941882398 2:170494555-170494577 CTTTGTATTTTTAGTGGAGACGG - Intronic
941948066 2:171122115-171122137 TTTTGTATTTTTAGTGAAGACGG + Intronic
942202588 2:173586535-173586557 CTTTGTATTTTTAGTGGAGATGG - Intergenic
942586452 2:177484514-177484536 TTTTGTATTTTTAGTGAAGATGG + Intronic
942639541 2:178047289-178047311 TTTTGAATTTTTAGTAAAGACGG - Intronic
942986492 2:182148831-182148853 CCCTTAATTTGAGGTGAAGAAGG + Intronic
943014114 2:182490543-182490565 TTTTGTATTTTTAGTGAAGACGG + Intronic
944115790 2:196184789-196184811 TTTTGTATTTTTAGTGAAGACGG - Intergenic
944615921 2:201460069-201460091 CACTAATTTTGTAGTGAATAAGG - Intronic
944713623 2:202358031-202358053 TTTTGTATTTTTAGTGAAGATGG + Intergenic
945414898 2:209558952-209558974 CTCTGCCTCTGTAATGAAGAAGG + Intronic
945416121 2:209575347-209575369 TTCTGAATTTTTAGTAGAGACGG - Intronic
945705444 2:213225539-213225561 CTTTGTATTTTTAGTTAAGAAGG - Intergenic
946250462 2:218408241-218408263 TTTTGAATTTGTAGTAGAGATGG - Intergenic
947770976 2:232669769-232669791 CTTTGTATTTTTAGTGGAGACGG + Intronic
949051483 2:241899893-241899915 TTTTGTATTTTTAGTGAAGACGG - Intronic
1169172522 20:3476686-3476708 TTTTGAATTTTTAGTGGAGACGG - Intronic
1169452554 20:5724494-5724516 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1169561245 20:6803040-6803062 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1172233269 20:33351576-33351598 CTCTGTTGTTGTAGTAAAGATGG + Intergenic
1172246657 20:33450116-33450138 TTTTGAATTTTTAGTGGAGACGG + Intergenic
1172261508 20:33570106-33570128 CTTTGTATTTTTAGTAAAGATGG - Intronic
1172365154 20:34343470-34343492 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1172524120 20:35587316-35587338 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1172712279 20:36934826-36934848 TTTTGTATTTGTAGTAAAGATGG + Intronic
1173395825 20:42678469-42678491 TTTTGTATTTGTAGTGCAGATGG + Intronic
1173420450 20:42896463-42896485 TTTTGTATTTTTAGTGAAGACGG - Intronic
1173513149 20:43646034-43646056 TTTTGTATTTGTAGTGGAGACGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1173832903 20:46103866-46103888 CTTTGAATTTCAAGTGAAGGAGG - Intergenic
1173912362 20:46679735-46679757 TTTTGAATTTTTAGTGAAGACGG - Intronic
1174406779 20:50307992-50308014 TTTTGTATTTGTAGTGGAGACGG + Intergenic
1175120490 20:56712660-56712682 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1176383433 21:6125350-6125372 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1177073944 21:16548659-16548681 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1177159385 21:17531125-17531147 CTTTGTATTTTTAGTAAAGATGG - Intronic
1177233816 21:18359659-18359681 CTTTGATTTTGAAGTGAATATGG - Intronic
1177697915 21:24597473-24597495 TTTTGAATTTTTAGTAAAGATGG + Intergenic
1177705200 21:24695254-24695276 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1177819531 21:26016201-26016223 TTTTGTATTTTTAGTGAAGACGG + Intronic
1177920551 21:27147009-27147031 TTTTGTATTTGTAGTGGAGACGG + Intergenic
1177972533 21:27808361-27808383 TTCTGCATTTGTAGTAGAGACGG - Intergenic
1178023790 21:28441365-28441387 TTCTAAAATTCTAGTGAAGATGG + Intergenic
1178319633 21:31595620-31595642 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1178441975 21:32605665-32605687 CTCCAAATTTGTAGTCAAGCTGG + Intronic
1178813743 21:35908163-35908185 TTTTGTATTTTTAGTGAAGATGG + Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1180540337 22:16440560-16440582 TTCTTATTTTGTTGTGAAGATGG - Intergenic
1180854953 22:19039880-19039902 TTCTGAATTTTTTGTGGAGAAGG + Intronic
1182034947 22:27190598-27190620 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1182309131 22:29392248-29392270 TTTTGTATTTGTAGTGGAGATGG + Intronic
1182636780 22:31734141-31734163 TTCTGCATTTTTAGTAAAGATGG + Intronic
1183207260 22:36428025-36428047 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1183342310 22:37288239-37288261 CTCTGTATTTTTAGTAGAGATGG - Intronic
1183557081 22:38537382-38537404 CTCTGTATTTTTAGTAGAGACGG + Intronic
1183597404 22:38821062-38821084 TTTTGTATTTTTAGTGAAGATGG + Exonic
1183835077 22:40445718-40445740 TTCTGTATTTTTAGTAAAGACGG + Intronic
1183938084 22:41275606-41275628 TTTTGTATTTTTAGTGAAGATGG - Intronic
1184222063 22:43107297-43107319 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1184789761 22:46692732-46692754 CTTTGTATTTTTAGTAAAGATGG - Intronic
949591357 3:5497342-5497364 CTCAGAATTTGAGGTGAAGTGGG + Intergenic
950085077 3:10251554-10251576 CTTTGTATTTTTAGTGGAGATGG + Intronic
950270479 3:11610756-11610778 CCTTGAAATTCTAGTGAAGATGG - Intronic
950869404 3:16215737-16215759 TTCTGTATTTTTAGTGGAGACGG - Intronic
951031214 3:17884011-17884033 CTCTGAATCTGCAGGGAATATGG + Intronic
951731157 3:25811867-25811889 CAATGAACTTGTAATGAAGATGG + Intergenic
952320347 3:32271293-32271315 TTTTGTATTTGTAGTGGAGATGG + Intronic
952715746 3:36478791-36478813 TTTTGAATTTGTAGTAGAGATGG + Intronic
952785394 3:37149828-37149850 TTTTGAATTTTTAGTGGAGATGG - Intronic
953071767 3:39527627-39527649 CTTTGTATTTTTAGTGGAGATGG + Intronic
953669556 3:44951318-44951340 CTCTGAGTTTTCAGTGCAGAAGG + Intronic
953750788 3:45606962-45606984 TTCTGTATTTTTAGTGGAGACGG + Intronic
953908368 3:46879866-46879888 TTTTGCATTTGTAGTGGAGATGG - Intronic
954029251 3:47806615-47806637 TTTTGTATTTTTAGTGAAGATGG + Intronic
954063117 3:48085749-48085771 TTTTGAATTTTTAGTAAAGATGG - Intronic
954257071 3:49414361-49414383 TTTTGTATTTTTAGTGAAGACGG - Intronic
954813535 3:53262879-53262901 TTCTGTATTTTTAGTAAAGATGG + Intergenic
955216455 3:56988317-56988339 TTTTGTATTTGTAGTGGAGACGG + Intronic
955668477 3:61376141-61376163 TTCTGTATTTTTAGTAAAGATGG - Intergenic
955681931 3:61511183-61511205 CTCTGATTTTATAGTGATGATGG - Intergenic
956043999 3:65175769-65175791 CTCTGAACTTTAAGTGAATAGGG - Intergenic
956090395 3:65660302-65660324 CTCTGAGTTTATAGTCAAAAAGG + Intronic
956391077 3:68773185-68773207 CCCTGAATTTGTAGTCAAGTTGG - Intronic
956933765 3:74076252-74076274 CTCTGAAATTCTAGTGTAGTTGG - Intergenic
958531231 3:95333454-95333476 CTCAAAATTTCTAGTGAAAAAGG + Intergenic
958806452 3:98816951-98816973 TTCTGTATTTTTAGTGGAGATGG + Intronic
958965233 3:100551183-100551205 TTCTGTATTTTTAGTGGAGACGG + Intronic
959579206 3:107967033-107967055 CTCTGAATTGGAAGTGCAGAGGG + Intergenic
960630161 3:119722284-119722306 CTCTGTATTTTTAGTAGAGACGG - Intronic
961984090 3:131114004-131114026 CTGGGAATTTGGAGTGAGGAGGG + Intronic
962160028 3:132989341-132989363 TTTTGTATTTTTAGTGAAGATGG - Intergenic
962307018 3:134297390-134297412 TTTTGTATTTGTAGTAAAGACGG + Intergenic
962521791 3:136203931-136203953 TTTTGTATTTTTAGTGAAGACGG + Intergenic
962715992 3:138126653-138126675 TTTTGTATTTGTAGTGGAGACGG - Intronic
963157855 3:142118199-142118221 TTCTGAATTTGTAGTGATGATGG - Intronic
963333445 3:143943398-143943420 CTCTGCATTTTTAGTAGAGACGG - Intergenic
964224095 3:154377535-154377557 TTTTGTATTTGTAGTGGAGACGG + Intronic
964357827 3:155866517-155866539 TTTTGTATTTTTAGTGAAGATGG - Intergenic
964437275 3:156667399-156667421 CTCTGTTTTTATAGTAAAGAAGG - Intergenic
964816527 3:160723380-160723402 CTTTGAATTTTTAGTAGAGACGG - Intergenic
965062138 3:163797509-163797531 CTTTGTATTTTTAGTGAAGATGG + Intergenic
965431383 3:168593384-168593406 TTTTGAATTTTTAGTAAAGACGG - Intergenic
965906174 3:173709279-173709301 CTTAGAAGTTGTAGTAAAGAGGG + Intronic
966046109 3:175551724-175551746 TTTTGAATTTTTAGTGTAGACGG - Intronic
966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG + Intergenic
966241738 3:177761755-177761777 TTTTGTATTTGTAGTGGAGACGG - Intergenic
966689668 3:182729630-182729652 CTGTGTATTTTTAGTAAAGATGG - Intergenic
966772836 3:183519153-183519175 CTCTGGATTTGTAAAGGAGAGGG + Intronic
966817205 3:183899082-183899104 TTTTTAATTTGTAGTAAAGACGG - Intergenic
967963414 3:194942589-194942611 CCCTGAATTTGTAGCCAAGGGGG + Intergenic
969294347 4:6260971-6260993 CTTTGTATTTTTAGTAAAGATGG + Intergenic
969385043 4:6838956-6838978 TTCTGTATTTTTAGTGGAGATGG - Intronic
969830330 4:9790732-9790754 ATCTGAATTTCTAGGGAATAGGG + Intronic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
970090690 4:12404171-12404193 CTCTGAATTTACAGTGTGGAGGG - Intergenic
970405723 4:15761214-15761236 TTCTGTATTTTTAGTGGAGATGG + Intergenic
970918531 4:21365312-21365334 CTTTGTATTTTTAGTAAAGATGG - Intronic
970936183 4:21572795-21572817 TTTTGTATTTTTAGTGAAGATGG + Intronic
971132848 4:23832780-23832802 TTTTGTATTTTTAGTGAAGATGG + Intronic
971342210 4:25780994-25781016 TTCTGTATTTTTAGTGATGAGGG + Intronic
972065859 4:34942650-34942672 TTTTGAATTTTTAGTAAAGACGG - Intergenic
972537567 4:40012155-40012177 CCCTAAATATGTAGTGAAGATGG - Intergenic
972620034 4:40738445-40738467 TTCTGTATTTTTAGTAAAGATGG + Intergenic
972916547 4:43887865-43887887 TTTTGAATTTTTAGTAAAGACGG + Intergenic
973035271 4:45397967-45397989 CTTTGTATTTTTAGTGGAGACGG + Intergenic
973192261 4:47398960-47398982 TTCTGTATTTTTAGTGGAGACGG + Intronic
974268223 4:59614573-59614595 TTTGGAATTTGTAGTGAAAAGGG - Intergenic
974422288 4:61692612-61692634 TTTTGTATTTGTAGTAAAGATGG + Intronic
974562590 4:63541145-63541167 CTCTGAAATTGTAGTGCAGCAGG + Intergenic
974656906 4:64836937-64836959 TTTTGTATTTGTAGTGGAGACGG + Intergenic
974701718 4:65457900-65457922 TTTTGAATTTTTAGTGGAGACGG - Intronic
975444174 4:74443936-74443958 CTTTGTATTTTTAGTAAAGATGG + Intergenic
975450290 4:74517862-74517884 CTTTGTATTTTTAGTAAAGATGG + Intergenic
975652013 4:76603005-76603027 TTCTGTATTTGTACTAAAGATGG + Intronic
975940820 4:79643573-79643595 CTCAGAATTTTTAGTAAAGTGGG + Intergenic
976216823 4:82722895-82722917 TTTTGTATTTGTAGTGGAGACGG - Intronic
976232658 4:82861226-82861248 CTCTGAATTAGTACTGAACATGG - Intronic
976515608 4:85961571-85961593 CTCTAAACTTGTGGTGAATATGG + Intronic
976673631 4:87680911-87680933 TTCTGAATTTTTAGTAGAGACGG + Intergenic
976674321 4:87687450-87687472 TTTTGAATTTTTAGTAAAGATGG + Intergenic
976703130 4:87992992-87993014 CCCTGAATTTGTAGCCAAGCTGG - Intergenic
977412496 4:96685977-96685999 CTTTGTATTTTTAGTGGAGACGG - Intergenic
977565722 4:98578588-98578610 TTTTGTATTTGTAGTAAAGATGG + Intronic
978008602 4:103651326-103651348 CTCTGCCTTTGAAATGAAGACGG - Intronic
978812039 4:112860395-112860417 TTTTGTATTTTTAGTGAAGACGG + Intronic
979892217 4:126112546-126112568 TTCTGTATTTTTAGTAAAGATGG + Intergenic
981279756 4:142944433-142944455 CACTGATTTTTTAATGAAGAGGG - Intergenic
981734120 4:147931635-147931657 CTCTGTATTTGGAGAGAAGGTGG + Intronic
982142336 4:152337665-152337687 CTCTTAATTAGTGGTAAAGAGGG - Intronic
982698252 4:158629219-158629241 TTTTGTATTTGTAGTAAAGATGG + Intronic
983365857 4:166788009-166788031 TTTTGTATTTTTAGTGAAGACGG - Intronic
984153218 4:176160490-176160512 ATTTGTATTTGTAGTGGAGATGG + Intronic
984636954 4:182121166-182121188 TTCTGTATTTTTAGTGGAGACGG + Intergenic
984871994 4:184333873-184333895 CTTTGTATTTTTAGTGGAGATGG + Intergenic
985276103 4:188239504-188239526 CTCTGTATTTTTAGTAGAGATGG + Intergenic
986444848 5:7812350-7812372 CTCTGTATGTATAGTGAACAGGG - Intronic
986686200 5:10277260-10277282 TTTTGAATTTTTAGTGGAGATGG + Intronic
987239510 5:15980512-15980534 TTCTGAAAATGTAGTGGAGATGG - Intergenic
987348505 5:16999845-16999867 TTCTGTATTTGTAGTAGAGATGG - Intergenic
987350497 5:17017730-17017752 CTCTGTATTTTTAGTAGAGATGG + Intergenic
987365511 5:17145089-17145111 CTGTGATTTTGTAATAAAGAGGG - Intronic
987723786 5:21670728-21670750 CTCTGTATTTTTTGTGGAGATGG + Intergenic
988329825 5:29821362-29821384 TTTTGTATTTTTAGTGAAGATGG + Intergenic
988383548 5:30531524-30531546 CTCTGAATTAGCAGAGAAGGAGG - Intergenic
988432006 5:31129952-31129974 TTCTGTATTTTTAGTGGAGATGG + Intergenic
988489375 5:31693410-31693432 TTCTGTATTTTTAGTAAAGACGG + Intronic
989150541 5:38294995-38295017 TTTTGTATTTTTAGTGAAGACGG + Intronic
990402358 5:55451731-55451753 TTCTGTATTTGTAGTAGAGACGG + Intronic
991245387 5:64504470-64504492 CCCTGAATTTGTCGCCAAGATGG - Intergenic
991365098 5:65859968-65859990 TTCTGTATTTTTAGTAAAGACGG - Intronic
991673175 5:69067789-69067811 TTCTGTATTTTTAGTAAAGACGG + Intergenic
992254103 5:74904560-74904582 TTCTGTATTTTTAGTAAAGACGG + Intergenic
993178303 5:84517115-84517137 TTCTGTATTTGTAGTAGAGATGG - Intergenic
993360881 5:86974885-86974907 CTGTGAATTTGTAGTGAATAAGG - Intergenic
993661066 5:90635763-90635785 CTTTGTATTTTTAGTAAAGATGG + Intronic
993989288 5:94636888-94636910 TTTTGTATTTTTAGTGAAGATGG + Intronic
994096087 5:95849377-95849399 TTCTGCATTTCTAGTGGAGATGG + Intergenic
995406867 5:111807868-111807890 CTCTGAATATCATGTGAAGATGG + Intronic
995942590 5:117601492-117601514 CTCTCAATTTGGAGTTTAGATGG + Intergenic
995963782 5:117878837-117878859 TTCTGAATTATTAGTGAAAATGG + Intergenic
995972150 5:117985513-117985535 TTCTGTATTTTTAGTAAAGATGG + Intergenic
995991285 5:118242746-118242768 CTATGAGTTGGTAATGAAGAAGG - Intergenic
996254113 5:121376959-121376981 TTTTAAATTTTTAGTGAAGACGG - Intergenic
996652234 5:125892961-125892983 TTTTGTATTTTTAGTGAAGATGG - Intergenic
997125207 5:131219764-131219786 TTTTAAATTTGTAGTAAAGATGG - Intergenic
997533727 5:134599411-134599433 TTTTGAATTTGTAGTAGAGACGG + Intergenic
997550229 5:134745966-134745988 TTTTGAATTTGTAGTAGAGACGG - Intronic
997759710 5:136433332-136433354 CTTTGAATATTTAGTGAGGATGG - Intergenic
997929122 5:138057891-138057913 TTCTGTATTTTTAGTGGAGATGG - Intergenic
997954662 5:138269669-138269691 TTTTGTATTTGTAGTGGAGATGG - Intronic
997977873 5:138450814-138450836 TTTTGTATTTTTAGTGAAGACGG + Intergenic
998665187 5:144288797-144288819 TTCTGTATTTTTAGTAAAGACGG - Intronic
998807819 5:145936142-145936164 CTCTGAATTTAGAGATAAGAGGG - Intergenic
998962673 5:147505403-147505425 CTCTGTATTTTTAGTAGAGACGG + Intronic
999023501 5:148197758-148197780 TTCTGTATTTTTAGTAAAGATGG + Intergenic
999333914 5:150698796-150698818 CTCTGAATTTTTGCTGGAGAAGG - Intronic
1000186057 5:158859237-158859259 CTCTGATTTTCCAGTGAACATGG - Intronic
1000414741 5:160972048-160972070 CTGTGAATTTGGGGTGAATATGG - Intergenic
1000694859 5:164368172-164368194 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1000696342 5:164389560-164389582 CTATGAATTTCTTGTAAAGATGG + Intergenic
1001341783 5:170853510-170853532 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1001632812 5:173188886-173188908 TTTTGAATTTGTAGTAGAGATGG + Intergenic
1002028152 5:176409583-176409605 TTCTGTATTTTTAGTAAAGACGG + Intronic
1002502297 5:179654932-179654954 TTCTGCATTTTTAGTAAAGACGG + Intergenic
1002506052 5:179679827-179679849 TTTTGTATTTTTAGTGAAGACGG + Intronic
1002627561 5:180541622-180541644 TTTTGTATTTTTAGTGAAGACGG + Intronic
1003363284 6:5449176-5449198 TTTTGCATTTGTAGTAAAGATGG - Intronic
1003397245 6:5763934-5763956 CTCTGACTTTGGACTGAGGATGG - Intronic
1003582185 6:7349760-7349782 TTTTGTATTTGTAGTAAAGATGG - Intronic
1004006757 6:11643934-11643956 CTCTGAACAAGTAATGAAGATGG - Intergenic
1004320011 6:14625024-14625046 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1004343377 6:14826904-14826926 CTTTGAATTTCTAGTGAGCAAGG + Intergenic
1004367421 6:15023752-15023774 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1004466635 6:15891564-15891586 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1004485914 6:16066360-16066382 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1004506030 6:16247543-16247565 TTTTGTATTTTTAGTGAAGATGG + Intronic
1004613561 6:17268615-17268637 CTCTGAATTTGTTGTCAACTGGG - Intergenic
1004940913 6:20555489-20555511 TTTTGAATTTTTAGTGGAGACGG + Intronic
1004967816 6:20874671-20874693 TTCTGTATTTTTAGTGGAGATGG + Intronic
1005148522 6:22721129-22721151 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1006121262 6:31807411-31807433 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1006177719 6:32132761-32132783 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1006225164 6:32531377-32531399 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1006494056 6:34408676-34408698 TTCTGTATTTTTAGTAAAGACGG + Intronic
1006721226 6:36153054-36153076 TTCTGTATTTTTAGTGCAGAGGG + Intergenic
1006759555 6:36447456-36447478 TTCTGAATTTTTAGTAGAGACGG - Intronic
1007549030 6:42715036-42715058 TTTTGTATTTTTAGTGAAGATGG - Intronic
1008066042 6:47049734-47049756 TTTTGTATTTGTAGTAAAGATGG - Intergenic
1008235501 6:49042526-49042548 CTCTGAATTTTATGTGGAGAAGG - Intergenic
1008738551 6:54577056-54577078 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1009185935 6:60574525-60574547 TTTTGTATTTGTAGTGGAGATGG + Intergenic
1010440701 6:75890513-75890535 TTTTGTATTTGTAGTGGAGACGG + Intronic
1011411920 6:87074987-87075009 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1011420706 6:87169209-87169231 TTTTGTATTTTTAGTGAAGACGG + Intronic
1011421420 6:87177155-87177177 TTCTGTATTTTTAGTAAAGACGG - Intronic
1012264888 6:97129709-97129731 TTTTGTATTTTTAGTGAAGACGG - Intronic
1012470712 6:99569595-99569617 CTTTGTATTTTTAGTGGAGAGGG + Intergenic
1013296469 6:108762097-108762119 CTTTGCATTTGTAGTAGAGATGG - Intergenic
1014034778 6:116753667-116753689 ATATGAATTTGAAGTGCAGAAGG + Intronic
1014403462 6:121019664-121019686 TTCTCAATTTGCAGTGGAGATGG - Intergenic
1014562703 6:122910400-122910422 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1015520758 6:134129028-134129050 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1016514713 6:144881145-144881167 TTTTGAATTTTTAGTAAAGATGG - Intergenic
1016835585 6:148473422-148473444 TTCTGTATTTTTAGTGGAGATGG + Intronic
1017257109 6:152346335-152346357 TTTTGTATTTTTAGTGAAGACGG + Intronic
1017398455 6:154030717-154030739 CTCTGTATTTTTAGTAGAGATGG - Intronic
1017478887 6:154829734-154829756 TTCTGTATTTTTAGTGGAGACGG - Intronic
1017689151 6:156945835-156945857 TTTTGTATTTTTAGTGAAGATGG - Intronic
1017794895 6:157835181-157835203 TTCTGTATTTTTAGTGGAGATGG + Intronic
1017904619 6:158749049-158749071 CTCTGTATTTTTAGTAGAGACGG - Intronic
1019554481 7:1621934-1621956 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1020902835 7:14026980-14027002 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1021103203 7:16607393-16607415 TTCTGCATTTTTAGTAAAGACGG - Intronic
1021280950 7:18717599-18717621 CTCTGTATTTTTAGTGGAGATGG + Intronic
1021328989 7:19311241-19311263 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1021710688 7:23413028-23413050 TTCTGTATTTTTAGTTAAGATGG + Intronic
1021896383 7:25239851-25239873 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1022036325 7:26537985-26538007 TTCTTTATTTGTAATGAAGATGG + Intronic
1025216200 7:57058843-57058865 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1025612913 7:63094013-63094035 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1025655182 7:63511887-63511909 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026208268 7:68278769-68278791 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1026316372 7:69231201-69231223 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1026891882 7:73987129-73987151 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1027153926 7:75753070-75753092 CTTTGTATTTTTAGTAAAGATGG + Intergenic
1027180088 7:75932845-75932867 CTTTGTATTTGTAGTAGAGATGG - Intronic
1027824755 7:83097348-83097370 TTTTGTATTTGTAGTGGAGATGG - Intronic
1027883315 7:83871372-83871394 TTTTGAATTTTTAGTAAAGACGG + Intergenic
1028763125 7:94517697-94517719 GTCTTAATATGTAGTGGAGAGGG + Intronic
1028786792 7:94803844-94803866 CTTTGTATTTTTAGTAAAGATGG + Intergenic
1029229656 7:99055792-99055814 TTTTGTATTTGTAGTGGAGACGG - Intronic
1029250867 7:99235350-99235372 TTTTGAATTTTTAGTAAAGATGG + Intergenic
1029557667 7:101281561-101281583 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1029839421 7:103346301-103346323 TTCTGTATTTGTAGTAGAGACGG + Intronic
1030040077 7:105441555-105441577 TTTTGTATTTTTAGTGAAGACGG + Intronic
1030845102 7:114400025-114400047 CTCTGTATTTTTAGTAGAGACGG + Intronic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1032438705 7:131924215-131924237 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1032694700 7:134324963-134324985 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1033139487 7:138812659-138812681 TTTTGTATTTTTAGTGAAGACGG + Intronic
1033158613 7:138977868-138977890 CTCTGTATTTTTAGTAGAGACGG + Intronic
1033239127 7:139662788-139662810 CTTTGTATTTTTAGTAAAGATGG + Intronic
1033576497 7:142690310-142690332 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1033916675 7:146334710-146334732 CTCTGCAAGTGTAATGAAGAGGG + Intronic
1033950699 7:146781054-146781076 CTCTGTATTTTTAGTAGAGACGG - Intronic
1033959913 7:146902054-146902076 TTTTGTATTTGTAGTGGAGACGG + Intronic
1033990108 7:147272677-147272699 TTTTGTATTTGTAGTGGAGATGG + Intronic
1033997189 7:147365231-147365253 TTCTGTATTTGTAGTAGAGACGG - Intronic
1034124490 7:148658842-148658864 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1034180231 7:149131513-149131535 TTCTGTATTTGTAGTAGAGATGG - Intronic
1034181195 7:149139548-149139570 CTTTGTATTTTTAGTGGAGACGG - Intronic
1034854767 7:154532915-154532937 CTCTGACTTTCTTCTGAAGAAGG + Intronic
1035098410 7:156376219-156376241 TCCTGATTTTGTTGTGAAGATGG + Intergenic
1035142531 7:156777105-156777127 CTCTGTATTTTTAGTAGAGATGG + Intronic
1035208839 7:157312746-157312768 CTCTGCATTTTTAGTAGAGATGG - Intergenic
1035693692 8:1577396-1577418 TTTTGAATTTTTAGTAAAGATGG - Intronic
1036022793 8:4866098-4866120 CTTTGAATTAGTAGTGCAGTTGG - Intronic
1036920304 8:12847472-12847494 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1037242304 8:16791200-16791222 CTTTGTATTTTTAGTGCAGACGG + Intergenic
1037360523 8:18068967-18068989 TTCTGAATTTTTAGTAGAGACGG - Intronic
1037468016 8:19179125-19179147 TTTTGTATTTTTAGTGAAGAGGG + Intergenic
1037519086 8:19662211-19662233 TTTTGTATTTGTAGTGGAGATGG - Intronic
1038464390 8:27747547-27747569 TCCTGAAATTCTAGTGAAGAAGG - Intronic
1038702085 8:29858158-29858180 TTTTGCATTTTTAGTGAAGATGG - Intergenic
1039054935 8:33528486-33528508 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1039225783 8:35386890-35386912 CTCTGAATTTTTTCTGAAGGTGG + Intronic
1039509350 8:38078461-38078483 TTTTGTATTTGTAGTAAAGATGG - Intergenic
1039634766 8:39152549-39152571 CTTTGTATTTTTAGTGGAGACGG - Intronic
1040011935 8:42668617-42668639 CTTTGAATTTTTAGTAGAGACGG + Intergenic
1041393214 8:57366328-57366350 CTCTGAATTACTACTGAAGTTGG + Intergenic
1041674377 8:60523327-60523349 TTTTGTATTTTTAGTGAAGACGG + Intronic
1041817256 8:61988276-61988298 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1042204726 8:66317598-66317620 TTTTGAATTTTTAGTGGAGATGG - Intergenic
1042291238 8:67171226-67171248 TTCTGTATTTTTAGTAAAGATGG - Intronic
1042328708 8:67555625-67555647 CTCTGAATTTGTAGTCAGCCAGG + Intronic
1042355776 8:67825926-67825948 TTTTGAATTTGTAGTAGAGATGG + Intergenic
1042497905 8:69476211-69476233 ATTTGTCTTTGTAGTGAAGAAGG - Intronic
1042563374 8:70090394-70090416 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1042830943 8:73027819-73027841 CTCTAAATAAGTAGTTAAGATGG - Intronic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1042895973 8:73668159-73668181 CTGTAGACTTGTAGTGAAGAAGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043226551 8:77739341-77739363 ATAAGAATTTGTAGTTAAGATGG + Intergenic
1043446289 8:80322713-80322735 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1043552521 8:81390809-81390831 CTCTGCATTTTTTGTAAAGATGG - Intergenic
1043579979 8:81700767-81700789 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1043768488 8:84167227-84167249 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1044084967 8:87933200-87933222 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1044213901 8:89584550-89584572 CTTTGTATTTTTAGTAAAGACGG + Intergenic
1044371562 8:91418315-91418337 CTCTGAAGCTGTAGTGTAGATGG + Intergenic
1044435979 8:92164806-92164828 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1045473201 8:102531308-102531330 CTTTGTATTTTTAGTAAAGACGG - Intronic
1045910403 8:107400728-107400750 TTCTGTATTTTTAGTAAAGACGG + Intronic
1046743212 8:117850082-117850104 GTATGAATTTGTAATGTAGATGG + Intronic
1046775946 8:118163701-118163723 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1046966165 8:120168232-120168254 CTCTGACCTTCTGGTGAAGATGG - Exonic
1047091808 8:121583466-121583488 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1047326791 8:123846901-123846923 TTCTGTATTTTTAGAGAAGACGG - Intergenic
1047327427 8:123853323-123853345 TTCTGTATTTTTAGAGAAGACGG + Intronic
1047498505 8:125425629-125425651 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1047735567 8:127762062-127762084 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1048471281 8:134706519-134706541 TTCTGTATTTTTAGTGGAGACGG - Intronic
1048620590 8:136128609-136128631 CTTTGTTTTTGTAGTAAAGATGG + Intergenic
1048930260 8:139309425-139309447 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1049122156 8:140748321-140748343 TTCTGTATTTTTAGTAAAGATGG - Intronic
1050027701 9:1352795-1352817 ATCTGAAGTTGAAGTGAAAAAGG - Intergenic
1050088312 9:1990166-1990188 CTTTGTATTTTTAGTAAAGATGG - Intergenic
1051254631 9:15200826-15200848 TTCTGAATTTTTAGTAGAGACGG - Intronic
1051362346 9:16292311-16292333 CTCTGACTTCTTTGTGAAGAAGG + Intergenic
1051701176 9:19825690-19825712 CTCTGAATTTGTTGTGGGGCAGG - Intergenic
1052600066 9:30615859-30615881 CTTTGAATTTTTAGTAGAGATGG - Intergenic
1052672378 9:31574511-31574533 CTCAGACTCTGCAGTGAAGAAGG + Intergenic
1052786774 9:32835702-32835724 CTTTGTATTTGTAGTAGAGATGG - Intergenic
1053408778 9:37901336-37901358 TTCTGTATTTTTAGTGGAGACGG + Intronic
1053826701 9:42032366-42032388 CTGTGGATTTTAAGTGAAGATGG - Intronic
1054460003 9:65457675-65457697 TTGTGTATTTGTAGTAAAGACGG + Intergenic
1054603858 9:67155057-67155079 CTGTGGATTTTAAGTGAAGATGG + Intergenic
1054759641 9:68992984-68993006 CTCTGTATTTTTAGTACAGATGG - Intronic
1054761380 9:69007341-69007363 CCCCAAAATTGTAGTGAAGAAGG - Intronic
1054804522 9:69385089-69385111 TTTTGAATTTTTAGTGGAGATGG + Intronic
1055491530 9:76809523-76809545 TTTTGAATTTTTAGTAAAGACGG - Intronic
1055520064 9:77071740-77071762 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1056607041 9:88094474-88094496 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1056696277 9:88856739-88856761 CTCTGGATTGGTACTGAGGAGGG - Intergenic
1057249031 9:93484742-93484764 CTTTGTATTTTTAGTGGAGATGG + Intronic
1058009469 9:99960612-99960634 TTTTGTATTTTTAGTGAAGACGG + Intronic
1058524966 9:105848598-105848620 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1059372082 9:113849956-113849978 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1059910916 9:119043209-119043231 CTCTAAATTTGTGGTGAGGAGGG - Intergenic
1059924720 9:119197064-119197086 CACTGAATTTGTGGTCAAGTAGG + Intronic
1060857332 9:126925374-126925396 TTTTGTATTTTTAGTGAAGAGGG - Intronic
1060928350 9:127471614-127471636 CTTTGTATTTTTAGTAAAGATGG - Intronic
1060951447 9:127606417-127606439 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1061439024 9:130586919-130586941 TTTTGTATTTTTAGTGAAGACGG + Intronic
1061447353 9:130647794-130647816 CTTTGAATTTTTAGTAGAGACGG - Intergenic
1061453133 9:130679501-130679523 CTTTGCATTTGTAGTAGAGATGG + Intronic
1061456927 9:130705345-130705367 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1062314252 9:135958217-135958239 TTCTGTATTTTTAGTAAAGATGG + Intronic
1185473548 X:399679-399701 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1185582071 X:1217363-1217385 ATTTGTATTTTTAGTGAAGACGG - Intergenic
1185663077 X:1742502-1742524 CTTTGTATTTTTAGTAAAGACGG - Intergenic
1186100117 X:6146960-6146982 TTTTGTATTTGTAGTAAAGACGG + Intronic
1186534752 X:10335071-10335093 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1187174675 X:16885531-16885553 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1187768530 X:22669593-22669615 CTTTGTATTTTTAGTGGAGACGG - Intergenic
1187940308 X:24374689-24374711 CTCTGAAGCTGCAGGGAAGAGGG + Intergenic
1188260163 X:28014355-28014377 CACTGAATTGATGGTGAAGAGGG - Intergenic
1188292375 X:28405484-28405506 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1189359910 X:40341998-40342020 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1189633977 X:42985421-42985443 CTCTGAATTTTTGCTGAATATGG + Intergenic
1189709802 X:43797689-43797711 TTCTAAATTTGTGGTGAAGGTGG - Intronic
1189799250 X:44676609-44676631 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1189807740 X:44752320-44752342 TTTTGAATTTTTAGTGAAGACGG - Intergenic
1190156078 X:47993418-47993440 CTCTGAATTTGTAGTCAACCAGG + Intronic
1190884351 X:54518379-54518401 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1192235487 X:69292847-69292869 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1192475561 X:71438790-71438812 TTTTGTATTTTTAGTGAAGACGG - Intronic
1193584086 X:83299505-83299527 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1193677510 X:84474118-84474140 CTTTGTATTTTTAGTAAAGACGG - Intronic
1194717977 X:97308847-97308869 TTTTGAATTTTTAGTAAAGATGG - Intronic
1195216188 X:102705618-102705640 CTCTGTATTTTTAGTAGAGATGG + Intergenic
1196247942 X:113422729-113422751 TTCTGAATTTGTAGAAAACAGGG + Intergenic
1196430612 X:115620862-115620884 TTTTGTATTTTTAGTGAAGACGG + Intronic
1196462556 X:115945219-115945241 TTTTGCATTTTTAGTGAAGATGG - Intergenic
1196610408 X:117707907-117707929 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1197326748 X:125103813-125103835 CTTTGTATTTTTAGTAAAGATGG - Intergenic
1197930306 X:131687849-131687871 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1198063938 X:133077047-133077069 TTGAGACTTTGTAGTGAAGAAGG - Intronic
1198240517 X:134780403-134780425 TTTTGTATTTGTAGTGGAGATGG - Intronic
1198526365 X:137505248-137505270 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1198829344 X:140732031-140732053 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1200319842 X:155176336-155176358 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1200634674 Y:5636048-5636070 CTCTGAAATGGTCCTGAAGATGG - Intronic
1200748537 Y:6923687-6923709 ATCTGTATTTTTAGTGGAGACGG + Intronic
1201301642 Y:12510238-12510260 GTTTGTATTTTTAGTGAAGACGG - Intergenic
1201849877 Y:18467394-18467416 TTTTGAATTTGTAGTAGAGATGG + Intergenic
1201883441 Y:18852981-18853003 TTTTGAATTTGTAGTAGAGATGG - Intergenic
1202084526 Y:21122217-21122239 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1202110871 Y:21418042-21418064 CTCTGAATTTATAATAAAAATGG + Intergenic
1202178994 Y:22123389-22123411 CTATGAATTTGCAGTGAATTAGG - Intergenic
1202212367 Y:22463005-22463027 CTATGAATTTGCAGTGAATTAGG + Intergenic
1202301098 Y:23415241-23415263 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1202569713 Y:26255357-26255379 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1202585272 Y:26417433-26417455 TTCTGTATTTGTAGTAGAGAGGG - Intergenic