ID: 1163916536

View in Genome Browser
Species Human (GRCh38)
Location 19:20245245-20245267
Sequence GCTCATTTAGGACCTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163916524_1163916536 30 Left 1163916524 19:20245192-20245214 CCAGAGTAAACAAGAGAGGATGT No data
Right 1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG No data
1163916527_1163916536 3 Left 1163916527 19:20245219-20245241 CCATGGGAGAAACCCCTCCCTTG No data
Right 1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG No data
1163916530_1163916536 -9 Left 1163916530 19:20245231-20245253 CCCCTCCCTTGGTGGCTCATTTA No data
Right 1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG No data
1163916531_1163916536 -10 Left 1163916531 19:20245232-20245254 CCCTCCCTTGGTGGCTCATTTAG No data
Right 1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163916536 Original CRISPR GCTCATTTAGGACCTAAGAC TGG Intergenic
No off target data available for this crispr