ID: 1163916782

View in Genome Browser
Species Human (GRCh38)
Location 19:20247058-20247080
Sequence ATGCACTTGGAGGGTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 6, 1: 30, 2: 20, 3: 28, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163916782_1163916788 16 Left 1163916782 19:20247058-20247080 CCTTTTTAACCCTCCAAGTGCAT 0: 6
1: 30
2: 20
3: 28
4: 144
Right 1163916788 19:20247097-20247119 AAACAGGCCTGTTAAACTCTGGG No data
1163916782_1163916790 18 Left 1163916782 19:20247058-20247080 CCTTTTTAACCCTCCAAGTGCAT 0: 6
1: 30
2: 20
3: 28
4: 144
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data
1163916782_1163916789 17 Left 1163916782 19:20247058-20247080 CCTTTTTAACCCTCCAAGTGCAT 0: 6
1: 30
2: 20
3: 28
4: 144
Right 1163916789 19:20247098-20247120 AACAGGCCTGTTAAACTCTGGGG No data
1163916782_1163916787 15 Left 1163916782 19:20247058-20247080 CCTTTTTAACCCTCCAAGTGCAT 0: 6
1: 30
2: 20
3: 28
4: 144
Right 1163916787 19:20247096-20247118 GAAACAGGCCTGTTAAACTCTGG No data
1163916782_1163916786 0 Left 1163916782 19:20247058-20247080 CCTTTTTAACCCTCCAAGTGCAT 0: 6
1: 30
2: 20
3: 28
4: 144
Right 1163916786 19:20247081-20247103 AAAGCATTATATAAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163916782 Original CRISPR ATGCACTTGGAGGGTTAAAA AGG (reversed) Intergenic
901564523 1:10102279-10102301 ATGCACCTGGAGTGTTAACCTGG + Intronic
902683297 1:18058849-18058871 AACCACTTGGAGGTTTAAAGAGG + Intergenic
902986617 1:20158413-20158435 ATGCACTTGGAGGGTTAAGAAGG - Intergenic
903817426 1:26074985-26075007 ATAGACTTTGAGGGTTAAACAGG - Intergenic
905061627 1:35144808-35144830 ATGCACTTAGAGGGTTAAACAGG + Intergenic
909292467 1:73901374-73901396 ATGGACTTTCAGAGTTAAAATGG + Intergenic
911973368 1:104463767-104463789 ATGCACTTGGAGGGTTAAAAAGG + Intergenic
912191173 1:107342690-107342712 ATGAACTTGGAGAATTTAAAAGG - Intronic
916102979 1:161408724-161408746 ATGCACTTGGAGGGTTAAACAGG + Intergenic
917601461 1:176578393-176578415 ATGCACTTGCAAGGTTACTAGGG + Intronic
917755983 1:178098639-178098661 ATGCTCTTGGAGAGTTAGAAGGG + Intronic
918647200 1:186918387-186918409 ATGCACTTGGAGGGTTAGAGAGG + Intronic
920984805 1:210876839-210876861 ATGCACTTAGAGGGGTATATTGG - Intronic
922282318 1:224137882-224137904 ATTCACTAGAGGGGTTAAAATGG + Intronic
923147026 1:231205361-231205383 ATGCATTTGGGGGGTTGAATAGG + Intronic
1063264359 10:4431205-4431227 AGATACTTTGAGGGTTAAAAAGG - Intergenic
1063923173 10:10951566-10951588 ATGTCCTTGGAGGAGTAAAATGG - Intergenic
1065553092 10:26888612-26888634 ATGCACTTAAGGGGTTCAAAAGG + Intergenic
1066390393 10:34973450-34973472 ATGCACTTGAAGGGTTAAAAAGG - Intergenic
1067529257 10:47058638-47058660 ATGCACTGGGAGGATTTGAAGGG + Intergenic
1069371893 10:67756808-67756830 ATACACTTGAATGGTTAAAATGG + Intergenic
1071209814 10:83327516-83327538 ATGCACATGGAATGTTAAGAAGG - Intergenic
1071282214 10:84113165-84113187 ATGCACTTGGAGGGATAGAAAGG - Intergenic
1071487402 10:86111609-86111631 AGGGACTTGGAGGGATAAAGGGG + Intronic
1072743887 10:97926740-97926762 ATGCACTTGAAGTGTTCAGAGGG + Intronic
1073845419 10:107548410-107548432 CTGCACTTGGAAGGGTAAATGGG - Intergenic
1074468865 10:113708625-113708647 TTGCATTTGGAGGGTTGAGATGG + Intronic
1075236385 10:120734575-120734597 CTGCCCTTGGAGGGTCACAAAGG - Intergenic
1076201848 10:128565499-128565521 TTACACTTGAAGGGTAAAAATGG - Intergenic
1077589043 11:3477562-3477584 ACGCACTTGAAGGGTTGAAAAGG + Intergenic
1077738017 11:4812087-4812109 CTGCAATTGCAGGGTTACAAAGG + Intronic
1080112383 11:28582591-28582613 AAGCACTTTGAGGGTGAAAATGG - Intergenic
1081478252 11:43458299-43458321 ATGGACTTGGAGGGATCACATGG - Intronic
1081729251 11:45357423-45357445 ATGGACTGGGATGGTGAAAATGG - Intergenic
1084244738 11:67849185-67849207 ACGCACTTGAAGGGTTGAAAAGG + Intergenic
1084827948 11:71745371-71745393 ACGCACCTGAAGGGTTGAAAAGG - Intergenic
1085848732 11:80096072-80096094 AAGAACCTGAAGGGTTAAAATGG + Intergenic
1087965335 11:104405951-104405973 AAGAACTTGGATGGATAAAAGGG + Intergenic
1089428209 11:118398570-118398592 ATACACTTGGAAGCTTAAAAAGG + Exonic
1090670790 11:128943792-128943814 AGGAATTTGGAGGGATAAAACGG - Intergenic
1092415302 12:8286330-8286352 ACGCACTTGAAGGGTTGAAAAGG + Intergenic
1093289286 12:17301575-17301597 ATGCACTTGGAGGGTTAAAAAGG - Intergenic
1093382090 12:18505440-18505462 AAACATTTGGAGGGATAAAAAGG + Exonic
1096509015 12:52116897-52116919 ATGCACTTGAAGGGTTAAAAAGG + Intergenic
1097886677 12:64735879-64735901 ATTCTCTTGGAAGGGTAAAATGG - Intronic
1098446479 12:70570925-70570947 GAGCATTTGGAGGGATAAAAGGG - Intronic
1099892273 12:88604677-88604699 ATCTACTTGGGGGGCTAAAAAGG - Intergenic
1100455327 12:94746099-94746121 ATGCAGTGGGAAGGATAAAAAGG - Intergenic
1101029259 12:100643909-100643931 ACGAACTTGGAGGGTTAGAAAGG + Intergenic
1104292899 12:127485543-127485565 ATGCATTTGGAGGGTTAAAAAGG - Intergenic
1106339991 13:28819224-28819246 GTGCACCTGGAGGTTTGAAAAGG - Intergenic
1106739526 13:32624847-32624869 ATGCACTTGGAGATGCAAAAGGG - Intronic
1106824668 13:33507498-33507520 ATACATTTTAAGGGTTAAAAGGG + Intergenic
1107490512 13:40876665-40876687 ATGCACTTGGAGGGTTAAAAAGG + Intergenic
1109214771 13:59576897-59576919 ATGCTCCTGGACTGTTAAAATGG + Intergenic
1109802992 13:67401888-67401910 ATGCACTTGGAGGGTTAGAAAGG - Intergenic
1112127833 13:96488638-96488660 ATGCACTTGGTGGGTAGAACTGG + Intronic
1112212023 13:97387465-97387487 ATGCACTTGGAGCTTTAGAGGGG - Intronic
1114737362 14:25056085-25056107 TTGTAATTGGAGGATTAAAAGGG + Intergenic
1115761074 14:36580017-36580039 AGGCACTTGCAGGCTTAAATAGG + Intergenic
1117038787 14:51751642-51751664 ATGCACTTGAAGGCTTAAAAAGG - Intergenic
1117701770 14:58420984-58421006 ATGCAATTGCAGGGTTATATGGG - Intronic
1117862369 14:60105899-60105921 ATGAACTTGGAGGGATAGACTGG - Intronic
1120644805 14:87061161-87061183 ATGCCATTAGAAGGTTAAAATGG + Intergenic
1120939872 14:89937422-89937444 ATGGACTTGCAGGGTCAAGAAGG - Intronic
1125926135 15:43564699-43564721 ATGCAAATGGAGGGGTGAAAGGG + Intronic
1125939279 15:43664250-43664272 ATGCAAATGGAGGGGTGAAAGGG + Intronic
1127096315 15:55515130-55515152 ACGCACTTGGAGGGTTAGAAAGG + Intergenic
1127394139 15:58530001-58530023 ATCCACTTGGTGTGGTAAAACGG + Intronic
1128490930 15:68143293-68143315 ATACACTAGGAGGCTAAAAAAGG + Intronic
1131045556 15:89312051-89312073 ATGCTCAAGAAGGGTTAAAAGGG - Intronic
1131633529 15:94205726-94205748 ATTTTCTTGGAGGCTTAAAATGG - Intergenic
1135644345 16:24148297-24148319 TTGCTCTTGGAGTGTTTAAATGG - Intronic
1137980934 16:53068963-53068985 ATGCATTAAGATGGTTAAAATGG - Intronic
1138763187 16:59568252-59568274 TTGCACATGTTGGGTTAAAAAGG + Intergenic
1143874190 17:9979458-9979480 ATGCACCTGTAGGGTAAAGAAGG + Intronic
1145864853 17:28234537-28234559 ATGCACTTGAAGGGTTAAAAAGG + Intergenic
1146520829 17:33524273-33524295 ATGTACTGGGAAGGCTAAAAAGG - Intronic
1149076117 17:52597477-52597499 ATGCACTTGGAGAGTTAAAAAGG - Intergenic
1149251413 17:54774360-54774382 ATACATTTTGAGGATTAAAAGGG + Intergenic
1151940231 17:77287440-77287462 ATCCACATGGAGAGTTGAAATGG - Intronic
1153469914 18:5432488-5432510 ATGCATTAGCAGTGTTAAAAAGG - Intronic
1153752005 18:8241982-8242004 ATGCACGTGGAGGATTAGAAGGG + Intronic
1153840599 18:9004696-9004718 ATAGACTTGGATGGTGAAAATGG - Intergenic
1155008030 18:21746889-21746911 ATTCAGTTGAAGGTTTAAAAGGG + Intronic
1155175830 18:23300256-23300278 ATGCTCTTGAAGGGCTACAAGGG - Intronic
1155177468 18:23313424-23313446 GAGCACTTGGAGGCTTACAAAGG + Intronic
1156272224 18:35546073-35546095 AAGCACTTGCAGGGATAGAAGGG - Intergenic
1157942235 18:51942081-51942103 ATAGACTTGGAGTTTTAAAAGGG - Intergenic
1160090228 18:75819829-75819851 ATTCACTTGGAAAGTTAACAGGG + Intergenic
1163916782 19:20247058-20247080 ATGCACTTGGAGGGTTAAAAAGG - Intergenic
1163943219 19:20513865-20513887 ATGCACTTGGAGGGTTAGAAAGG + Intergenic
1164481044 19:28611227-28611249 ATGCACTTGGAGAGTTAAAAAGG - Intergenic
1167942597 19:52959652-52959674 ATGCACTTGAAGGGTTAAAAAGG - Intronic
926139340 2:10359138-10359160 ATGCCCTTTGAGGGGGAAAAGGG + Intronic
927420075 2:22921420-22921442 ATGCACTAGGAGTTTTAAAATGG - Intergenic
928124365 2:28605623-28605645 GGGCACTTGTAGGGTCAAAAAGG + Intronic
928879434 2:36081323-36081345 ATGCATTTGGAGGGAGAAAATGG - Intergenic
930189566 2:48443487-48443509 ATGCACTTTGAGAGTTAATCAGG + Intronic
930518542 2:52435481-52435503 CTGCACTTGTAGGGTTAAGAAGG - Intergenic
930759529 2:55018799-55018821 ATCCACTGAAAGGGTTAAAATGG + Intronic
931698391 2:64889256-64889278 ATGCACTTGGAGGGTTAAGAAGG + Intergenic
932263312 2:70345107-70345129 ATGCTCTTGGTGGGGTAAATTGG - Intergenic
932353432 2:71049704-71049726 ACGCACTTGAAGGGTTAAAAAGG - Intergenic
936268406 2:111029355-111029377 AGGCAATTAGAGGGTTATAATGG + Intronic
937090154 2:119200876-119200898 ATGACCTTGGAGGGTTAAGTGGG + Intergenic
937411993 2:121684812-121684834 ATGCACTTGGAGGGTTAAACAGG + Intergenic
938858042 2:135335936-135335958 AAGCACTTGGTGAGTTTAAATGG - Intronic
939698258 2:145355997-145356019 ATGCAGCCGTAGGGTTAAAAAGG + Intergenic
940874400 2:158885329-158885351 ATGCACTTGAAGGGTTAAAAAGG - Intergenic
946887616 2:224239244-224239266 ATGCACATAGAGGGTAAAAATGG + Intergenic
947594995 2:231405487-231405509 ATGCACTTGAAGGGTTAAAAAGG - Intergenic
1169242274 20:3993660-3993682 CTGCACTGGTAGGGTTAGAATGG + Intronic
1170848307 20:19981077-19981099 AGGCATTCGGAGGATTAAAAGGG - Intronic
1171408538 20:24930205-24930227 ATGCACTTGAAGGGTTAAAAAGG - Intergenic
1171862545 20:30413919-30413941 AGCTACTTGGAAGGTTAAAATGG - Intergenic
1172850523 20:37959544-37959566 AAGCACTAGGAGGGATAAAGTGG - Intergenic
1174917172 20:54665567-54665589 TTTAACTTGGAGGGTTTAAATGG - Intergenic
1175877618 20:62237961-62237983 ATGCAGCTGGAGGGGTAAATTGG + Intronic
1177507329 21:22035691-22035713 ATGCACTTGTATGGTTATCATGG - Intergenic
1178447706 21:32660752-32660774 ATGCACTTGGAGGGTTAGAAAGG - Intronic
1182859352 22:33545891-33545913 ATGCTATTAAAGGGTTAAAATGG - Intronic
1185242970 22:49756272-49756294 CTGCACTTGGAGGGGGAACAAGG - Intergenic
949158108 3:851114-851136 ATGCACTTGCAGGGTTAAGAAGG - Intergenic
950714303 3:14836860-14836882 AGGCACTCGCAGGGTTAACATGG + Intronic
952002925 3:28808226-28808248 ATGCTCTGTGAGGGTTATAAGGG - Intergenic
955620007 3:60853103-60853125 ACTCAGTTGGAGGGCTAAAAAGG - Intronic
957022492 3:75140916-75140938 ATGCACTTGAAGAGTTAAAAAGG - Intergenic
957076193 3:75604936-75604958 ATGCACTTGAAGGGTTAAAAAGG + Intergenic
957255565 3:77831997-77832019 GTGAACTTGGAGGGTTTATATGG - Intergenic
957564703 3:81869164-81869186 ATACATTTGGATGGTCAAAAAGG + Intergenic
959956647 3:112246590-112246612 ATACACTTGGAAGCTTAAAAAGG - Intronic
961892852 3:130144944-130144966 ACGCACTTGAAGGGTTGAAAAGG + Intergenic
962134504 3:132720525-132720547 ATGCACTTGCATGTATAAAATGG - Intronic
962619555 3:137163757-137163779 ATGCAAATGGTGGGTTTAAAGGG + Intergenic
964522406 3:157583232-157583254 ATGCACTTGGAGGGTTAGAAAGG + Intronic
965715159 3:171594943-171594965 ATTCAGCTGGAGGATTAAAAAGG + Intergenic
967868764 3:194212441-194212463 AGGCCCTTGGAGGGTGAAAGAGG - Intergenic
969646972 4:8436434-8436456 ATGCAGTTGGAGGGTTAAACAGG - Intronic
969749911 4:9102197-9102219 ATGCACTAGAAGGGTTAAAAAGG - Intergenic
969752218 4:9119896-9119918 ATGCCCTTGGAGGGGGACAACGG + Intergenic
971497509 4:27282763-27282785 ATGAACTTGAAGGTTTAACATGG + Intergenic
972200431 4:36708127-36708149 ATTCACTTTGAGGTATAAAATGG + Intergenic
975955427 4:79831425-79831447 ATACTCCTGGAGGCTTAAAAAGG - Intergenic
975986934 4:80208710-80208732 ATGCATTTGGAGGAGGAAAAGGG - Intergenic
976784999 4:88809278-88809300 AAGTAATTGGAGAGTTAAAAAGG - Intronic
977271355 4:94921007-94921029 ATGCAATTTAATGGTTAAAATGG - Intronic
979818615 4:125142640-125142662 ATGACCTTGGAGGGAGAAAATGG - Intergenic
980066981 4:128200408-128200430 ATACACTTTGAGGATTAATATGG + Intronic
980780140 4:137483022-137483044 ATGCACTTGGAGGGTTAGAAAGG - Intergenic
982637421 4:157914552-157914574 ATGAATTTGGAGAGTTAACAGGG - Intergenic
988423430 5:31034410-31034432 ATGTATATGGATGGTTAAAATGG + Intergenic
994164517 5:96595173-96595195 ATGCACATGCAGGCATAAAATGG + Intronic
994465864 5:100129809-100129831 ATGCACTACCAGAGTTAAAAAGG + Intergenic
996115029 5:119608876-119608898 ATGAACTTGGAGTTTTAAAAGGG + Intronic
999936933 5:156496848-156496870 ATGCCCATGGAGGGTTAAGAGGG - Intronic
1002408140 5:179052461-179052483 GTGCACTTGGAGGGTTAGAAAGG + Intergenic
1002966104 6:1968094-1968116 ATGAGTTTGGAGGGGTAAAAGGG - Intronic
1003688767 6:8330920-8330942 TTCCACTTAGAGTGTTAAAAGGG + Intergenic
1007398257 6:41589514-41589536 ACGCACTGGGAGGGCTCAAATGG + Intronic
1008583079 6:52923713-52923735 ATGCACTTGGAGGGTTAAACAGG - Intergenic
1011565340 6:88666903-88666925 ATGCACTTGGAGGGTTAAAAAGG - Intronic
1012611700 6:101227174-101227196 ATGCACTTGGAGGGTTAAGAAGG + Intergenic
1014482160 6:121952185-121952207 ATGCTCTTGTATGGTCAAAAAGG - Intergenic
1016394789 6:143612106-143612128 ATCCACTTAAAGGATTAAAAAGG + Intronic
1018323962 6:162644366-162644388 ATGTACTTGCAGGATAAAAATGG + Intronic
1020307030 7:6843263-6843285 ATGCACTTAAAGGGTTAAAAAGG + Intergenic
1020311506 7:6872107-6872129 ATGCACTTGAAGGGTTCAAAAGG + Intergenic
1020323074 7:6954445-6954467 ATGCACTAGAAGGGTTAAAAAGG + Intergenic
1020691199 7:11356585-11356607 ATGCTCTCAGAGGGTTAAAGTGG + Intergenic
1021295886 7:18905306-18905328 AGGCACTTGAAGGTTTAATAAGG + Intronic
1021383933 7:20004552-20004574 ATGCACTTGAAAGTTTAAGAGGG + Intergenic
1021951775 7:25782060-25782082 ATGCAAATGGAGGCTTGAAAAGG - Intergenic
1024086320 7:45894502-45894524 ATGGGGTTGGAGGGTTAAAGGGG - Intergenic
1027870098 7:83695694-83695716 AGGCAATGGGAGGGTGAAAAGGG + Intergenic
1029078184 7:97952207-97952229 ATGCACTTGAAGGGTTAAAAAGG + Intergenic
1030095690 7:105897220-105897242 ACACACTTGAAGGCTTAAAATGG - Intronic
1031204020 7:118730391-118730413 AAGAAATTGGAGGGTTAAACTGG + Intergenic
1031437144 7:121746684-121746706 AGGCATATGGAGTGTTAAAATGG - Intergenic
1032170767 7:129582802-129582824 ATGTACTTAGAGGGTTAAGAAGG - Intergenic
1032589952 7:133182862-133182884 ATGGCCTTGGAGGCTGAAAATGG - Intergenic
1034243926 7:149630353-149630375 ATGTACAAGGAGGGATAAAAAGG - Intergenic
1036239825 8:7072296-7072318 ATGCACTTGAAAGGTTAAAAAGG - Intergenic
1036372990 8:8176537-8176559 ATGCATTTGAAGGGTTGAAAAGG - Intergenic
1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG + Intergenic
1036906008 8:12708948-12708970 ATGCACTTGAAGGGTTAAAAAGG + Intergenic
1038096746 8:24321151-24321173 ATATACTTGGAAGGTTAAAAAGG - Intronic
1038677056 8:29632662-29632684 ATGCAATTAGAAGTTTAAAAAGG + Intergenic
1038799119 8:30733345-30733367 ATGCACTTGAAGGGTTAAAAAGG - Intronic
1039215281 8:35263162-35263184 ATGGGCTTAGAGGGTTAAATAGG - Intronic
1039278378 8:35956245-35956267 ATACACTTGGAGAGTTAAAAAGG - Intergenic
1041008998 8:53523270-53523292 ATGCACTTGGAGGGTTAAAAAGG + Intergenic
1041030925 8:53734540-53734562 ATGTACTTGGAGGGTTAAGAAGG - Intronic
1041632276 8:60101506-60101528 ATGAAATTAGAAGGTTAAAAAGG - Intergenic
1042691688 8:71506568-71506590 ATGCACTCTGAGTGTAAAAAGGG + Intronic
1043579290 8:81693123-81693145 ATGCCTTTGGTGGGTTAACATGG + Intergenic
1044089718 8:87984233-87984255 ATGCCCTAGGACAGTTAAAATGG + Intergenic
1044141998 8:88667733-88667755 AAGAAATTGGAGGGTTAATAAGG - Intergenic
1049314536 8:141956095-141956117 AGGCATTTGGAGGGGTAAGAAGG + Intergenic
1052162723 9:25286942-25286964 ATTCACTTTGAGTTTTAAAATGG - Intergenic
1054841808 9:69750102-69750124 GTGCACATGGAGGCTTAATATGG + Intronic
1055413469 9:76056674-76056696 ATGCTCTTCAAGAGTTAAAATGG + Intronic
1058191906 9:101927757-101927779 ATTCCCTTGGAGTGTGAAAATGG - Intergenic
1060104376 9:120864262-120864284 ATGAACTTGGAGAGGTGAAAAGG - Intronic
1060915456 9:127386853-127386875 AGGCACCTGGAGTGTTAGAACGG - Intronic
1062224091 9:135439255-135439277 ATGCACTTGAAGGGTTAAAAAGG + Intergenic
1185909957 X:3972155-3972177 ATGCACTTGGAGGGTTAGAAAGG - Intergenic
1186035135 X:5414279-5414301 ATCCACTTAGAGTGTTAAACTGG - Intergenic
1188132072 X:26448381-26448403 ATCCATTTGGAGGGCTAAAAGGG - Intergenic
1190314779 X:49143528-49143550 ACGCAGTTGGAGAGTTAAAAAGG + Intergenic
1190425850 X:50333978-50334000 ATGCACTTGGAGGGTTAGAAAGG + Intronic
1191036042 X:56027470-56027492 ATGTACTTGAAGGGTTAGAAAGG + Intergenic
1193070208 X:77298564-77298586 ATGCACTTGGAGGGTTAGGAAGG - Intergenic
1194400546 X:93434428-93434450 ATGCACTTGAAGGGTTAAAAAGG - Intergenic
1196030079 X:111087302-111087324 ATTCTCTTGGATGATTAAAAAGG + Intronic
1198177550 X:134171905-134171927 GTGCACGTGGAGGGAAAAAAGGG - Intergenic
1198469646 X:136934413-136934435 ATGCACTTGGAGGGTTAAACAGG + Intergenic
1198711142 X:139505708-139505730 AAGCACTCTCAGGGTTAAAAAGG - Intergenic
1198970065 X:142269910-142269932 GTGTACTTGAAGGGTTAGAAAGG - Intergenic
1199058333 X:143324721-143324743 CTGCACTTGGAGAGTGAACATGG + Intergenic
1200116526 X:153772019-153772041 AGGCACTTGGAGGGTGAAGATGG + Intronic
1200394082 X:155972946-155972968 ATGCACTTGAAGGATTAGAAAGG + Intergenic
1200943377 Y:8807703-8807725 ATGCACATGGAGGGTTAGAAAGG - Intergenic
1201270349 Y:12247968-12247990 ATGTACTTGAATGGTTAGAAAGG - Intergenic
1201555099 Y:15259002-15259024 ATGCACTTGAAGGATTAGAAAGG - Intergenic
1201680517 Y:16640097-16640119 ATGTACTTGAAGGGTTAGAAAGG + Intergenic
1201696924 Y:16836221-16836243 ACGTACTTGAAGGGTTAGAAAGG - Intergenic
1202037295 Y:20647949-20647971 ATGTACTTGGAGAGTTAAAAAGG - Intergenic