ID: 1163916783

View in Genome Browser
Species Human (GRCh38)
Location 19:20247067-20247089
Sequence TAATGCTTTATGCACTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163916783_1163916786 -9 Left 1163916783 19:20247067-20247089 CCCTCCAAGTGCATAAAGCATTA No data
Right 1163916786 19:20247081-20247103 AAAGCATTATATAAAGAAACAGG No data
1163916783_1163916790 9 Left 1163916783 19:20247067-20247089 CCCTCCAAGTGCATAAAGCATTA No data
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data
1163916783_1163916789 8 Left 1163916783 19:20247067-20247089 CCCTCCAAGTGCATAAAGCATTA No data
Right 1163916789 19:20247098-20247120 AACAGGCCTGTTAAACTCTGGGG No data
1163916783_1163916788 7 Left 1163916783 19:20247067-20247089 CCCTCCAAGTGCATAAAGCATTA No data
Right 1163916788 19:20247097-20247119 AAACAGGCCTGTTAAACTCTGGG No data
1163916783_1163916787 6 Left 1163916783 19:20247067-20247089 CCCTCCAAGTGCATAAAGCATTA No data
Right 1163916787 19:20247096-20247118 GAAACAGGCCTGTTAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163916783 Original CRISPR TAATGCTTTATGCACTTGGA GGG (reversed) Intergenic