ID: 1163916784

View in Genome Browser
Species Human (GRCh38)
Location 19:20247068-20247090
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163916784_1163916789 7 Left 1163916784 19:20247068-20247090 CCTCCAAGTGCATAAAGCATTAT No data
Right 1163916789 19:20247098-20247120 AACAGGCCTGTTAAACTCTGGGG No data
1163916784_1163916790 8 Left 1163916784 19:20247068-20247090 CCTCCAAGTGCATAAAGCATTAT No data
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data
1163916784_1163916788 6 Left 1163916784 19:20247068-20247090 CCTCCAAGTGCATAAAGCATTAT No data
Right 1163916788 19:20247097-20247119 AAACAGGCCTGTTAAACTCTGGG No data
1163916784_1163916786 -10 Left 1163916784 19:20247068-20247090 CCTCCAAGTGCATAAAGCATTAT No data
Right 1163916786 19:20247081-20247103 AAAGCATTATATAAAGAAACAGG No data
1163916784_1163916787 5 Left 1163916784 19:20247068-20247090 CCTCCAAGTGCATAAAGCATTAT No data
Right 1163916787 19:20247096-20247118 GAAACAGGCCTGTTAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163916784 Original CRISPR ATAATGCTTTATGCACTTGG AGG (reversed) Intergenic
No off target data available for this crispr