ID: 1163916785

View in Genome Browser
Species Human (GRCh38)
Location 19:20247071-20247093
Sequence TATATAATGCTTTATGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163916785_1163916790 5 Left 1163916785 19:20247071-20247093 CCAAGTGCATAAAGCATTATATA No data
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data
1163916785_1163916787 2 Left 1163916785 19:20247071-20247093 CCAAGTGCATAAAGCATTATATA No data
Right 1163916787 19:20247096-20247118 GAAACAGGCCTGTTAAACTCTGG No data
1163916785_1163916789 4 Left 1163916785 19:20247071-20247093 CCAAGTGCATAAAGCATTATATA No data
Right 1163916789 19:20247098-20247120 AACAGGCCTGTTAAACTCTGGGG No data
1163916785_1163916788 3 Left 1163916785 19:20247071-20247093 CCAAGTGCATAAAGCATTATATA No data
Right 1163916788 19:20247097-20247119 AAACAGGCCTGTTAAACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163916785 Original CRISPR TATATAATGCTTTATGCACT TGG (reversed) Intergenic
No off target data available for this crispr