ID: 1163916790

View in Genome Browser
Species Human (GRCh38)
Location 19:20247099-20247121
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163916784_1163916790 8 Left 1163916784 19:20247068-20247090 CCTCCAAGTGCATAAAGCATTAT No data
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data
1163916785_1163916790 5 Left 1163916785 19:20247071-20247093 CCAAGTGCATAAAGCATTATATA No data
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data
1163916782_1163916790 18 Left 1163916782 19:20247058-20247080 CCTTTTTAACCCTCCAAGTGCAT 0: 6
1: 30
2: 20
3: 28
4: 144
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data
1163916783_1163916790 9 Left 1163916783 19:20247067-20247089 CCCTCCAAGTGCATAAAGCATTA No data
Right 1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163916790 Original CRISPR ACAGGCCTGTTAAACTCTGG GGG Intergenic
No off target data available for this crispr