ID: 1163927604

View in Genome Browser
Species Human (GRCh38)
Location 19:20360827-20360849
Sequence CTACCTCATATGACTTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163927596_1163927604 22 Left 1163927596 19:20360782-20360804 CCTACTGCTGAATGGAGTGAGTG No data
Right 1163927604 19:20360827-20360849 CTACCTCATATGACTTAGGGTGG No data
1163927600_1163927604 -4 Left 1163927600 19:20360808-20360830 CCTCTCTGTGGTTCCGTAGCTAC No data
Right 1163927604 19:20360827-20360849 CTACCTCATATGACTTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163927604 Original CRISPR CTACCTCATATGACTTAGGG TGG Intergenic
No off target data available for this crispr