ID: 1163933800

View in Genome Browser
Species Human (GRCh38)
Location 19:20423786-20423808
Sequence ACAAAAACAAAACTGCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163933800_1163933804 -1 Left 1163933800 19:20423786-20423808 CCCTAAGGCAGTTTTGTTTTTGT No data
Right 1163933804 19:20423808-20423830 TGTTCTTCCCCTATTGCCTGGGG No data
1163933800_1163933803 -2 Left 1163933800 19:20423786-20423808 CCCTAAGGCAGTTTTGTTTTTGT No data
Right 1163933803 19:20423807-20423829 GTGTTCTTCCCCTATTGCCTGGG No data
1163933800_1163933802 -3 Left 1163933800 19:20423786-20423808 CCCTAAGGCAGTTTTGTTTTTGT No data
Right 1163933802 19:20423806-20423828 TGTGTTCTTCCCCTATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163933800 Original CRISPR ACAAAAACAAAACTGCCTTA GGG (reversed) Intergenic