ID: 1163934373

View in Genome Browser
Species Human (GRCh38)
Location 19:20428865-20428887
Sequence CTCTGATACTAGGAGTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163934368_1163934373 13 Left 1163934368 19:20428829-20428851 CCTAATACTTCTACACAGTTTAT No data
Right 1163934373 19:20428865-20428887 CTCTGATACTAGGAGTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163934373 Original CRISPR CTCTGATACTAGGAGTAAGG TGG Intergenic
No off target data available for this crispr