ID: 1163935512

View in Genome Browser
Species Human (GRCh38)
Location 19:20439020-20439042
Sequence GATCAGAGCAGAACCCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163935512_1163935514 2 Left 1163935512 19:20439020-20439042 CCTGCTAGGGTTCTGCTCTGATC No data
Right 1163935514 19:20439045-20439067 TGTTATTTCTTTTTTTCTGCTGG 0: 7
1: 175
2: 349
3: 871
4: 3160
1163935512_1163935515 3 Left 1163935512 19:20439020-20439042 CCTGCTAGGGTTCTGCTCTGATC No data
Right 1163935515 19:20439046-20439068 GTTATTTCTTTTTTTCTGCTGGG 0: 13
1: 252
2: 667
3: 714
4: 2034
1163935512_1163935516 8 Left 1163935512 19:20439020-20439042 CCTGCTAGGGTTCTGCTCTGATC No data
Right 1163935516 19:20439051-20439073 TTCTTTTTTTCTGCTGGGTTTGG No data
1163935512_1163935517 9 Left 1163935512 19:20439020-20439042 CCTGCTAGGGTTCTGCTCTGATC No data
Right 1163935517 19:20439052-20439074 TCTTTTTTTCTGCTGGGTTTGGG No data
1163935512_1163935518 14 Left 1163935512 19:20439020-20439042 CCTGCTAGGGTTCTGCTCTGATC No data
Right 1163935518 19:20439057-20439079 TTTTCTGCTGGGTTTGGGTTTGG 0: 37
1: 463
2: 516
3: 558
4: 1135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163935512 Original CRISPR GATCAGAGCAGAACCCTAGC AGG (reversed) Intergenic
No off target data available for this crispr