ID: 1163939111

View in Genome Browser
Species Human (GRCh38)
Location 19:20476731-20476753
Sequence GGGTTTAAAGGCTCATGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 6, 1: 13, 2: 5, 3: 15, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163939103_1163939111 18 Left 1163939103 19:20476690-20476712 CCTTTTGGAGTAGACAGAAAGGT No data
Right 1163939111 19:20476731-20476753 GGGTTTAAAGGCTCATGGAGAGG 0: 6
1: 13
2: 5
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163939111 Original CRISPR GGGTTTAAAGGCTCATGGAG AGG Intergenic
900552532 1:3263968-3263990 GGGTTCCAGGGCTCAGGGAGGGG + Intronic
904036246 1:27560544-27560566 GGGTTTTCAGGGTCATGGTGTGG + Intronic
905382294 1:37571574-37571596 GGGTTTTAAGGGTTTTGGAGTGG - Intronic
905479347 1:38250375-38250397 TGGGTAAAAGGGTCATGGAGTGG + Intergenic
905883760 1:41480831-41480853 GGGTTTGAAGGCTCATGACTGGG - Intronic
910355016 1:86343310-86343332 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
915646435 1:157276087-157276109 GAGTTTAAAGGCTCATGGAGAGG + Intergenic
915736815 1:158090390-158090412 GGAATTAATGGCTCATGGTGTGG - Intronic
918355671 1:183705101-183705123 GGGTTTAAAGGCTCATGGAGAGG + Intronic
919911392 1:202113107-202113129 GGGGTCAAGGGCTCAGGGAGGGG + Intergenic
922685744 1:227637682-227637704 GGTTTTAAGGGCTCATGGAGAGG + Intronic
924001603 1:239559494-239559516 GGGTTTAAAGTTTGATGTAGTGG - Intronic
924722868 1:246639292-246639314 GGGTTTAAAGGCTTATGGAGAGG + Intronic
924867164 1:247996172-247996194 GGGTTCAATTGCCCATGGAGTGG - Intronic
924868392 1:248011783-248011805 GGGTTCAATTGCCCATGGAGTGG - Intronic
924871064 1:248044964-248044986 GGGTTCAATTGCCCATGGAGTGG - Intronic
1062937378 10:1398504-1398526 GGGGTTAGGGGCTCCTGGAGAGG - Intronic
1069574506 10:69517096-69517118 AGGTGTAATGGCTCAGGGAGTGG + Intergenic
1069940743 10:71953676-71953698 GGGTTTAGGGGTTCATTGAGAGG + Intergenic
1070572409 10:77650149-77650171 GAGTTTAAAGCCTCCTGCAGGGG - Intergenic
1070819493 10:79346717-79346739 GGGTTTAAATGCTCCTGCTGTGG + Intergenic
1070897323 10:79995980-79996002 GGGTTCTCAGGCTGATGGAGTGG - Intergenic
1072272327 10:93788858-93788880 GGGTTTAGAGGCTAATGGTATGG + Intronic
1072917155 10:99545069-99545091 GTGTTTAAAGGCTTAGGAAGGGG - Intergenic
1076538599 10:131199062-131199084 GGGTGGAAGGGCTCAGGGAGGGG - Intronic
1077526239 11:3067489-3067511 GGGCTTAAAGACTCATGGCTGGG - Intergenic
1078004036 11:7518988-7519010 GGGTTTACAGGCTTCAGGAGAGG + Intronic
1079166939 11:18053071-18053093 GGGTTGAAAGGCTATTGAAGGGG + Intergenic
1080520509 11:33064446-33064468 GAGTTTACAGGCTCATCGAATGG - Intronic
1082632125 11:55555780-55555802 GGGTTTAAAGGCTCATGGAGAGG - Intergenic
1082635110 11:55585051-55585073 GGGTTTAAAGGCTCTTGGAGAGG - Intergenic
1083543706 11:63533494-63533516 GGGTTTTATGGGTGATGGAGAGG - Intergenic
1084339652 11:68487771-68487793 GTGTTTTAAGGCTCATAGTGTGG + Intronic
1085803598 11:79613957-79613979 GGATTTAAAGGCTCATGGGAGGG - Intergenic
1085943639 11:81238605-81238627 GAATTTAAATGCACATGGAGAGG - Intergenic
1086822091 11:91446649-91446671 GGGGTTAAGGGCTCACAGAGAGG - Intergenic
1087048762 11:93866224-93866246 GGTTTTAAAGGCTCATGGAGAGG + Intergenic
1088884253 11:113994632-113994654 GGCTTCAAAGGCCCCTGGAGAGG - Intergenic
1091808973 12:3379189-3379211 GGGTTTATAGCCTAGTGGAGAGG - Intergenic
1102583943 12:113910223-113910245 GCGGTGAAAGGCTCAGGGAGAGG - Intronic
1103415328 12:120739027-120739049 GGGTTTACAGCCCCATGGGGAGG + Intronic
1105805827 13:23951128-23951150 GGGTGGAAAGGCTCATGGGGTGG - Intergenic
1107091923 13:36490677-36490699 GGGTTCAAAGGATCCTGGATTGG + Intergenic
1108832736 13:54499788-54499810 GGGTTTAAAGAGTTAGGGAGGGG - Intergenic
1110101698 13:71614160-71614182 TGGTTTAAATCATCATGGAGGGG + Intronic
1111985219 13:95059145-95059167 GGGTTTAAAGTCCCTAGGAGAGG + Intronic
1114237027 14:20832754-20832776 GGGTTTAAAGGCTCACGGAGGGG + Intergenic
1116225750 14:42149777-42149799 GGTATTAAAATCTCATGGAGTGG + Intergenic
1118942149 14:70347919-70347941 GGGTTTGAAGGCTCATGGAGAGG - Intronic
1118946096 14:70388698-70388720 GGGAGGAAAGGCTGATGGAGAGG + Intronic
1119142299 14:72278312-72278334 TGATTTACAGGCTCATGGTGAGG + Intronic
1121230561 14:92354519-92354541 TAGTTTACAGTCTCATGGAGAGG + Intronic
1122506927 14:102237559-102237581 GGATTTAGAGGCTCACTGAGAGG - Intronic
1123039692 14:105485437-105485459 GGGTTTCAAGGCTCATGGGCTGG + Intergenic
1124971425 15:34493469-34493491 TGGTTCAAGAGCTCATGGAGTGG + Intergenic
1125172907 15:36786854-36786876 GGGTTTGAAGGGTCAGAGAGAGG - Intronic
1125582937 15:40799969-40799991 TGGTGTGATGGCTCATGGAGAGG - Intronic
1125823292 15:42652626-42652648 TGGTTTAAAGGTACAAGGAGAGG - Intronic
1125907903 15:43410216-43410238 GGGTAAAAAGGCTGATGCAGTGG - Intronic
1126919500 15:53505166-53505188 GAGTTGAAAGGCTAATGGAATGG - Intergenic
1127570435 15:60236152-60236174 GGGTTTAGAGGTTCAGGAAGTGG + Intergenic
1128172476 15:65525179-65525201 GTGTTTAAAGACTGATGGAACGG - Intergenic
1128752117 15:70157060-70157082 GGGTAAACAGGCTCATGGATAGG - Intergenic
1130842685 15:87716225-87716247 GGGTTCATAGGCTCAGGGACTGG + Intergenic
1131668243 15:94592756-94592778 GTGCTTAGAGGCTCATGCAGTGG - Intergenic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1133031391 16:3012879-3012901 GGGTTTTAAGGCCCAGGCAGGGG - Exonic
1134441311 16:14301349-14301371 GGGGCTAAGGGCTCTTGGAGAGG - Intergenic
1135165989 16:20139537-20139559 GGGTTTTAAGGGTTTTGGAGTGG + Intergenic
1136120391 16:28129265-28129287 AGGTTTATAGGCTGAAGGAGGGG - Intronic
1137482676 16:48865439-48865461 GGCTTCAAAGGCTCAGGGATCGG + Intergenic
1140982506 16:80124444-80124466 GGGTTGAAAGGATCTAGGAGAGG - Intergenic
1144821906 17:18081086-18081108 GAGTTTAAATGCTTCTGGAGAGG - Intergenic
1145799321 17:27672988-27673010 GGGTCTAAAGCCTCAAGCAGGGG + Intergenic
1146908440 17:36632657-36632679 TGGGTGAAAGGATCATGGAGAGG + Intergenic
1149851123 17:60035158-60035180 GGGTTACAAAACTCATGGAGCGG - Intergenic
1149859041 17:60111349-60111371 GGGTTACAAAACTCATGGAGCGG + Intergenic
1152857420 17:82673772-82673794 AGATTGAAAGGCCCATGGAGTGG - Intronic
1153751464 18:8235975-8235997 GTGTTTAATGGCTCATGATGCGG + Intronic
1155657838 18:28211578-28211600 GGGTTTAAAGGCTCACGGAGAGG + Intergenic
1157920221 18:51706828-51706850 GGGTTTGAAGGCTCATGGTGAGG - Intergenic
1162588812 19:11577658-11577680 GGGAATAAAGGCTCAGGGACCGG - Exonic
1163939111 19:20476731-20476753 GGGTTTAAAGGCTCATGGAGAGG + Intergenic
927451827 2:23215343-23215365 GGGTTCAAAGGCTGCTGGGGAGG + Intergenic
932452243 2:71818968-71818990 AGGATTAAAGTCTGATGGAGGGG - Intergenic
933167880 2:79095358-79095380 GGTTTTAAAGGCTCATGGAGAGG + Intergenic
933823786 2:86139821-86139843 GGGATTAAGGACTCATGGAATGG + Exonic
935895763 2:107735853-107735875 GGGTTTCAAGGCTCACAGAGAGG - Intergenic
938584882 2:132680454-132680476 GGGTTTAGGGGTTCAAGGAGAGG - Intronic
938697805 2:133850229-133850251 GGAACTAAAGGCTTATGGAGCGG + Intergenic
939496508 2:142933388-142933410 GATTTTTAAGGCTCATGGAGTGG + Intronic
939496918 2:142935868-142935890 GGGTTTATAGGCTTCAGGAGAGG + Intronic
939697184 2:145341179-145341201 GGGTTTACAAGCTAATGGAGAGG + Intergenic
942169889 2:173279755-173279777 GTGTTTAAAGGCTCTAGGAGTGG - Intergenic
945569696 2:211450755-211450777 GGGTTTAGAGACTTATGGAGGGG - Intronic
948516384 2:238506342-238506364 GGGATTAGAGCCTCATGAAGGGG - Intergenic
1169324863 20:4667344-4667366 TGATGTAAAGGCTTATGGAGGGG + Intergenic
1171010964 20:21509231-21509253 GGGTTTCAAGTCTCTTGGAGCGG - Intergenic
1173038312 20:39434347-39434369 GGGTCTAAAGGGTCAAGGGGAGG + Intergenic
1177619084 21:23563182-23563204 GGGTGCATGGGCTCATGGAGAGG - Intergenic
1178998475 21:37430314-37430336 GTGTATTAAGACTCATGGAGAGG + Intronic
1179667232 21:42921286-42921308 GGGTTTAAAGGCTCATGGAGAGG + Intergenic
1181055222 22:20257831-20257853 GGGTGTGGGGGCTCATGGAGGGG - Intronic
1184959259 22:47917303-47917325 GGGTATAAAGGCTCCTGCTGAGG + Intergenic
949732543 3:7130571-7130593 AGGATTAATGGCCCATGGAGAGG + Intronic
954850269 3:53594107-53594129 GTGTGTAAAGGCTAATGGAATGG + Intronic
957186087 3:76943255-76943277 GGGGTCAGAGGCTCATGGAAGGG - Intronic
957357584 3:79112419-79112441 GGGATGACAGGGTCATGGAGTGG + Intronic
957919930 3:86733541-86733563 GGGCTGAAGGGCTCCTGGAGCGG + Intergenic
958881443 3:99675770-99675792 GTGTTTAAAGGCTTATGGGTTGG - Intronic
959212941 3:103411819-103411841 GGGTTTAAAGTCTCATCTATTGG + Intergenic
963585704 3:147185432-147185454 GGGTCTAAAGTCTAATGTAGCGG - Intergenic
965756483 3:172032863-172032885 GGGATTACAGGCTCATTCAGAGG + Intergenic
965811055 3:172592189-172592211 GGGTTCAAGGGCTCACTGAGAGG + Intergenic
965872454 3:173278319-173278341 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
966434711 3:179870409-179870431 GGTTTTTAAGGGTCTTGGAGTGG - Intronic
968551575 4:1226223-1226245 GGGTAAATAGGCTCAGGGAGGGG - Intronic
970580182 4:17467778-17467800 GGGTTTAAGGGCCCAGGGAATGG - Intronic
970794028 4:19891002-19891024 AGGTTCGAAGGCTCATAGAGAGG - Intergenic
973142587 4:46787127-46787149 CGGTTTAAAGCCTAATTGAGTGG + Intronic
974950195 4:68577591-68577613 GGGTTTACAGGCTTCAGGAGAGG - Intronic
974950621 4:68580166-68580188 GGTTTTAAAGGCTCATAGAGAGG - Intronic
974958598 4:68673155-68673177 GGGTTTACAGGCTCCGTGAGAGG - Intergenic
974959015 4:68675685-68675707 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
976299787 4:83506890-83506912 GGGTTTGAAGGCCCATGGAGAGG + Intronic
976481926 4:85556144-85556166 GGGTTTGAGGGCTCACAGAGAGG + Intronic
978242312 4:106530731-106530753 GGGTTTAAAAGCTCACATAGAGG + Intergenic
978493571 4:109334622-109334644 GGGTGTGAAGGCTGATGGTGGGG - Intergenic
987285408 5:16451258-16451280 GGGCTTGAAGGCTTATGTAGGGG - Intergenic
987966336 5:24880677-24880699 GGTTAGAAAGGCTCAAGGAGAGG - Intergenic
990185339 5:53204596-53204618 GGGTTTAAAGGTTCCTGGAGAGG - Intergenic
994895345 5:105696206-105696228 GGGTTTAATGGACAATGGAGAGG - Intergenic
999311793 5:150556210-150556232 TGGGGCAAAGGCTCATGGAGGGG - Exonic
1002915779 6:1526575-1526597 GGTTTCCAAGGCTCAGGGAGGGG - Intergenic
1005587727 6:27293305-27293327 GGGTTTAACGGCCCCTGGAATGG + Intronic
1006811184 6:36821543-36821565 GGGACAAAAGGCACATGGAGTGG + Intronic
1006944767 6:37777973-37777995 GGCTTTGCAGGCTCATGGAGAGG - Intergenic
1007722001 6:43890669-43890691 GGTTTTCAGGGCTAATGGAGGGG + Intergenic
1008784136 6:55144993-55145015 GGGGTTATATGCTAATGGAGAGG - Intronic
1011083094 6:83510789-83510811 GGGGTCAAAGGCTCAAGAAGGGG + Intergenic
1014964396 6:127729040-127729062 GGTTTTAAAGCCTCTTGGATAGG - Intronic
1015181787 6:130368681-130368703 GGGCTTATAGGCTGATGGAGAGG + Intronic
1016292554 6:142540422-142540444 CGGTTTGAAGATTCATGGAGAGG - Intergenic
1022003499 7:26246882-26246904 GGTTTTAAAGGCTCACGGATAGG - Intergenic
1023551560 7:41375320-41375342 GAGTTTCAAGGCTGAAGGAGAGG + Intergenic
1026125427 7:67575304-67575326 GGGATTAAAATTTCATGGAGGGG + Intergenic
1027577839 7:79953200-79953222 GAGATTTAAGGCTCAGGGAGAGG - Intergenic
1029123639 7:98283623-98283645 GAGTGTGAAGGCACATGGAGGGG + Intronic
1029131545 7:98335195-98335217 GGGATTTAGGGCTCATGGAGAGG - Intronic
1029698972 7:102233938-102233960 GAGTTTAAAGGCTCAGGGTTGGG - Intronic
1029803585 7:102974966-102974988 GGGTTTACAGGCTTCAGGAGAGG - Intronic
1032429527 7:131849541-131849563 GGGTGTTCAGGCTCAAGGAGGGG + Intergenic
1040499617 8:47995354-47995376 GGATTTAGGGGCTCATTGAGGGG + Intergenic
1042158277 8:65867109-65867131 GGGTTTGAAGGCTCATGGAGAGG - Intergenic
1044543450 8:93433183-93433205 GTGTTTAAAGGTCAATGGAGTGG - Intergenic
1047209862 8:122832592-122832614 GGGTTTGAAGTCTTATGGAGAGG + Intronic
1047718565 8:127618154-127618176 GGCTTTAAAGTCTCAGGGAGTGG - Intergenic
1047929368 8:129711611-129711633 GGGTTTCAAGGCTGATGAGGGGG + Intergenic
1048717132 8:137282730-137282752 GGGTTTACAGGCTTCAGGAGAGG - Intergenic
1053013219 9:34647202-34647224 GGGTTGAGAGGGTCATGGCGGGG - Exonic
1058575763 9:106399533-106399555 TGGTTTAAAGGCTCATTATGGGG + Intergenic
1185723228 X:2398567-2398589 GTATTTAAAGGCCCATGGAAAGG + Intronic
1187199457 X:17120945-17120967 AGGGTTAAAGGCTGATGGGGAGG - Intronic
1189733743 X:44048621-44048643 AGGTTTAAAGGGGCAGGGAGAGG - Intergenic
1191151207 X:57222261-57222283 GAGTTTAATGGCACATAGAGAGG - Intergenic
1191868968 X:65729380-65729402 AGGTTTTAAGGGTAATGGAGTGG - Intronic
1192282326 X:69699812-69699834 GGGTTTAAAGGCTCATGGAGAGG + Intronic
1192282333 X:69699845-69699867 GGGTTTAAAGGCTCATGGAGAGG + Intronic
1192788144 X:74354435-74354457 GGGCTTAGAGGCTCAATGAGTGG - Intergenic
1192945983 X:75966068-75966090 GGGTTTAAAGGCTCTTGGAGAGG + Intergenic
1195148823 X:102044611-102044633 GGGGTCAAAGGCTCACAGAGAGG - Intergenic
1196914020 X:120513410-120513432 GGTTTTAAAGGGTTTTGGAGTGG - Intergenic
1201743250 Y:17345485-17345507 GGGTTTAGGGGTTCATTGAGAGG + Intergenic
1201908002 Y:19104871-19104893 TGGTTTAATGTCTTATGGAGAGG + Intergenic